Цветы для альпийской горки многолетние название и фото: Растения для альпийской горки: названия многолетних цветов, цветущих все лето, устройство камней

Содержание

названия лучших цветов, многолетников и почвопокровных

Каменистый сад, украшенный цветником – довольно распространенный элемент многих садовых участков. Декоративная привлекательность и простота ухода за альпинарием послужили причиной такой популярности этого элемента ландшафтного дизайна. Скальные растения для альпийской горки всегда зрительно оживляют каменную композицию, но при этом сохраняют эффект естественного горного ландшафта.

Создать каменную композицию, которая станет эффектным украшением загородного участка, не сложно. Для этого при подборе растений для «каменистого сада» необходимо придерживаться следующих рекомендаций:

  • Создавая композицию, предпочтение следует отдавать компактным и низкорослым формам растений, которые соответствуют пропорциональным размерам самой горки.
  • Выбор растений осуществлять с учетом их устойчивости к условиям местности: особенности почвы, климата.
  • Выбирая место под укоренение, важно учитывать отношение растения к солнечному свету: солнечные участки – для светолюбивых представителей растительного мира, затененные – для теневыносливых.
  • Интенсивность разрастания и кущения отдельных видов – немаловажный момент, недочет которого может привести к гибели «соседей» стремительно наращивающего массу растения.
  • Создавая композиции важно учитывать особенности каждого из растительных обитателей альпинария с тем, чтоб избежать «неблагоприятное соседство». К примеру: весьма привлекательные и неприхотливые в уходе ясколка, мыльнянка, резуха и обриетта плохо воздействуют на своих «соседей».
  • Рассаживание растение желательно осуществлять с учетом их «общности интересов»: они должны сочетаться друг с другом не только по внешнему виду, но по схожести условий для выращивания, темпам роста и развития, а также ритму цветения.

Также будет полезен материал о выборе подходящих камней для альпийской горки: https://diz-cafe.com/dekor/kamni-dlya-alpijskoj-gorki.html

Выбирая многолетние цветы для озеленения альпийской горки, следует ориентироваться не только на месторасположение альпинария на участке, но и на общую стилистику композиции

Наиболее эффектное сочетание дают комбинации травянистых многолетников с кустарниковыми и древовидными формами, украшенные пестрыми ковриками красивоцветущих стелющихся видов и сочными зелеными штрихами вечнозеленых и декоративнолиственных видов

Идеальными растениями для «каменистого сада» являются медленнорастущие древесные и низкорослые растения. Хвойные для альпийской горки позволяют обеспечить высокую декоративность композиции на протяжении всего года.

В миниатюрных каменных композициях великолепно смотрятся стелющиеся и карликовые формы хвойных культур: миниатюрная ель канадская «Conica», сосна черная «Nana», можжевельник чешуйчатый «Blue Carpet», туя западная «Danica»

Сочетая в одной композиции хвойники с различной формой кроны и окраской хвои, можно значительно усилить живописный эффект.

О том, как правильно оформить композицию из декоративных хвойников, можно узнать из материала: https://diz-cafe.com/ozelenenie/dekorativnye-xvojniki.html

Среди лиственных кустарников для альпийской горки явными фаворитами являются декоративные формы барбариса, кизильника, хеномелеса, спиреи

Трудно представить себе альпинарий без цветов. Красивоцветущие многолетники для альпийской горки позволяют придать любому саду неповторимого стиля и уникальности. При создании композиций выбор не ограничивается лишь растениями, характерными для альпийской местности. В «каменистом саду» уместно будут смотреться и представители растительного мира, основная среда обитания которых лесные массивы и морское побережье.

Ярким украшением альпинария могут стать: камнеломка Арендса, флокс шиловидный, эрика травянистая, эдельвейс альпийский, песчанка балеарская, иберис вечнозеленый, колокольчик карпатский и многие другие.

Вершина альпийской горки

Верхний ярус «каменистого сада» засаживается, как правило, засухоустойчивыми и солнцелюбивыми видами растений, поскольку этот участок наиболее открыт солнечному свету, но при этом влага в почвенном слое практически не задерживается. При оформления вершины композиции используются почвопокровные растения.

О лучших почвопокровных многолетних растениях для сада, подробнее можно узнать из материала: https://diz-cafe.com/ozelenenie/pochvopokrovnye-rasteniya-dlya-sada.html

Ярким украшением вершины могут стать многолетняя гвоздика и иберис вечно зеленый

Пушистый ковер ибериса укроет вершину белоснежными цветами в мае-июне, подушкоподобные кустики гвоздики будут радовать обильным цветением и приятным ароматом на протяжении всего лета

Солнцелюбивый эдельвейс, растущий на склонах неприступных гор может стать главным украшением альпинария, а пышные фиолетовые коврики тимьяна ползучего привлекут медовым ароматом цветков множество пчел и бабочек

Средний ярус каменной композиции

Украсить среднюю часть каменистой горки могут растения, предпочитающие солнечные участки, но при этом легко переносящие легкое затенение. На среднем уровне более высокая влажность грунта. Это дает возможность расширить ассортимент растений для оформления влаголюбивыми красавцами.

В майские дни заиграет буйным цветом розовых, голубых и белоснежных оттенков флокс шиловидный. Эффектным фоном для флокса может выступить чистец шерстистый с приятными на ощупь серебристыми опушенными листьями

Благородные серебристые оттенки имеют также анафалис трехжилковый и полынь Шмидта.

Обриетта – универсальное растение для озеленения, поскольку помимо шикарного цветения в летние месяцы, она имеет декоративную листву, сочность цвета и привлекательность которой сохраняется в течение всего года.

В конце мая эстафету цветения примет красотка обриетта культурная, радуя взор пышными потоками нежно-розовых, насыщенно-малиновых и темно-фиолетовых цветков

Хорошо подходит для среднего яруса и неприхотливый в уходе полукустарник солнцецвет монетчатый. На солнечных участках яруса можно разместить всевозможные очитки, которые формируются в симпатичные подушкоподобные кустики, украшенные в летние месяцы миниатюрными звездочками-цветками

Если выбирать среди названий цветов для альпийской горки, комфортно себя чувствующих в наших широтах, то склоны горки могут украсить всевозможные луковичные, разнообразные гейхеры, плотные кустики армерии, нежная альпийская астра, первоцветы примулы, осеннецветущий безвременник прекрасный.

Подножие альпинария

У подножия высаживают растения, которые любят произрастать на богатой влагонасыщенной почве и не боятся затенения.

Цветовые акценты подножия композиции можно расставить с помощью компактных кустиков камнеломки и колосовидных цветков лиатриса

Нижний ярус отводится также для размещения древовидных и кустарниковых растений. Нередко на этой части горки размещают групповые посадки миниатюрных карликовых хвойников, рододендронов.

Оцените статью: Поделитесь с друзьями!

Растения для альпийской горки (фото и названия), как выбрать

Альпийская горка — цветник, олицетворяющий гармоничное единение живой и неживой природы. Как и в настоящих Альпах, здесь сквозь суровые каменные глыбы навстречу солнцу пробиваются разнообразные растения и цветы. Чтобы добиться такого же природного созвучия и, в то же время, полноценного развития растений, следует очень тщательно отнестись к их подбору. Мы поможем вам подобрать растения для альпийской горки, фото и названия сделают их для вас узнаваемыми.

Особенности подбора растений для альпинария

Чтобы альпийская горка удалась на славу, очень важно не ошибиться с выбором растений и правильно их посадить. Конечно, многое будет зависеть от вашего вкуса и фантазии, но существуют некоторые общие правила подбора растений для альпийской горки, которые очень важно соблюдать.

  • Растения должны быть достаточно неприхотливы и подходить к вашим климатическим условиям.
  • Предпочтение стоит отдавать низкорослым и компактным видам. Чем меньше по площади ваш альпинарий, тем более миниатюрные растения должны его украшать.
  • Высаживайте растения, хорошо уживающиеся друг с другом и имеющие сходные требования к условиям произрастания.
  • Избегайте быстроразрастающихся видов, они будут угнетать соседние растения.
  • При посадке учитывайте требования ваших зеленых друзей к освещенности и влажности.
  • Очень важно, чтобы альпийская горка сохраняла декоративность на протяжении всего года. Для этого необходимо учитывать жизненный цикл различных растений и сроки их цветения.

Виды растений для альпийской горки

Альпийская горка — это сложный цветник, и создается он на долгие годы, поэтому основу композиции должны составлять многолетние растения. Их выбор настолько широк, что можно перестараться с избытком и пестротой цветов, нарушить концепцию альпинария. Для этого не поленитесь нарисовать схему, указывая сроки цветения выбранных вами растений. Потрудитесь над этим один раз, и вы избежите ошибок, получите достойную цветочную композицию.

Многолетние растения

Они составляют основу альпинария. Перечислить все невозможно. Выбирая многолетние цветы, не забывайте, что в горном пейзаже неуместно будут выглядеть крупные сортовые виды (например, гладиолусы, георгины). Отдавайте предпочтение некрупным, нежным, которые ассоциируются с дикой природой.
Конечно, подойдут для альпинария истинно горные растения: армерия (Armeria), цветущая в расщелинах скал, эринус альпийский (Erinus alpinus) и другие.

Армерия
Эринус альпийский

Возле крупных камней можно посадить дрок красильный (Genista tincioria), злаки и папоротники. Например, аспелениум (Asplenium), многоножку (Polypodium), пузырник (Cystopteris) и скребницу (Ceterach officinarum). Злаковые — овсянница (Festuca), овес вечнозеленый (Helictotrichon sempervirens), ковыль (Stipa). Можно использовать некоторые виды полыни (Artemisia), так как они имеют весьма декоративные и пряно-ароматные листья различных оттенков. Добавит натуральности скальному пейзажу декоративный мох Дикранум (Dicranum) и Гипновый мох (Hypnum).

Дрок красильный
Декоративный мох Дикранум

Уместны будут такие растения для альпинария, как астра альпийская (Aster alpinus) и кустарниковая (Aster dumosus), иссоп лекарственный (Hyssopus officinalis), колокольчики низкорослые (Campanula), тысячелистник (Achillea), дицентра (Dicentra), лен (Linum), аквилегия (Aquilegia), декоративные сорта лука (Аllium), лаванда узколистная (Lavandula officinalis), горечавка (Gentiana), гвоздики (Dianthus), мелколепестник (Erigeron), фиалки (Viola), душица обыкновенная (Origanum vulgare), незабудки (Myosotis), зверобой (Hypericum) и многие другие.

Иссоп лекарственный
Лен
Гвоздика

Ну и, конечно, «изюминкой» вашей композиции станет истинно альпийский цветок — эдельвейс (Leontopodium). Его серовато-белые войлочные корзинки не блещут яркой красотой, но посаженные группками, они создают необыкновенный природный колорит горной местности.

Эдельвейс

Однолетники

Однолетние цветы для альпийской горки, как палочка-выручалочка, помогут вам заполнить возникающие пустоты (проплешины) и закрыть увядающие луковичные. Например, портулак крупноцветковый (Portulaca grandiflora), мезембриантемум (Mesembryanthemum), бархатцы (Tagetes), газания (Gazania), эшшольция (Eschscholzia), декоративный злак зайцехвостник (Lagurus ovatus) и другие.

Мезембриантемум
Декоративный злак зайцехвостник

Мелколуковичные

Ну какая же клумба без луковичных цветов! Луковичные растения для альпийской горки следует выбирать низкорослые и некрупные.
Уместны там мускари (Muscari), крокусы (Crocus), безвременники (Colchicum), пролески (Scilla), подснежники (Galanthus), хиодоноксы (Chionodoxa), иридодиктиумы (Iridodictyum), птицемлечник (Ornithogalum). Из тюльпанов (Tulip) следует остановиться на ботанических видах, таких как тюльпаны Кауфмана.

Тюльпаны Кауфмана

Все эти луковичные цветы нежны и красивы, но у них короткий срок декоративности, это нужно учитывать, определяя их место в альпинарии.

Почвопокровные

Очень важные растения для альпийской горки — почвопокровные. Ведь именно они декорируют камни и склоны. Мы порекомендуем некоторые, из них вы сможете подобрать подходящие по цветовой гамме и срокам цветения.
Аллисум (Alyssum) — цветет в конце весны, серебристые слегка опушенные листочки красиво сочетаются с желтыми и белыми цветками.

Иберис (Iberis) — есть однолетние и многолетние виды. Образует красивые «подушки» и хорошо заполняет пространство под высокими многолетниками. Время цветения меняется в зависимости от сорта.

Арабис (Arabis) — существует множество видов однолетних и многолетних, все они имеют стелющийся стебель. Есть виды с декоративными листьями.

Камнеломка (Saxifraga) — собранные розетку листья и цветоносы образуют плотную маленькую «подушку», из которых можно сформировать цветущий ковер.

Камнеломка

Обриета (Aubrieta) — образует коврики, густо усыпанные цветками. В зиму уходит с листьями. Цветение очень продолжительное. Окраска цветков зависит от сорта.

Ясменник (Asperula) — горный цветок, прекрасно подходящий для альпинария. Бывает однолетним и многолетним. Хорошо растет в скальных трещинах.

Вероника (Veronica) — ее горные почвопокровные виды украсят альпийскую горку.

Тимьян (Thymus) — все его виды просто шикарные растения для альпинария. У него множество достоинств, он образует густые ароматные коврики с обилием мелких цветочков.

Мшанка шиловидная (Sagina subulat) — образует зеленые «подушки», похожие на мох. Цветет обильно маленькими цветками все лето.

Мшанка шиловидная

Мыльнянка (Saponaria) — имеет виды для высаживания в каменные расщелины, а также почвопокровные. Цветки могут быть белыми или нежно-розовыми.

Флокс шиловидный (Phlox subulata) — образует красивейшие цветущие ковры, придает очарования грубым каменным глыбам.

Живучка (Ajuga) — это симпатичное растение замечательно растет на скалистых склонах, однако, может очень сильно разрастаться.

Очиток белый (Sedum album) — порадует вас белым ковриком из ароматных маленьких цветков.

Молодило (Sempervivum) — различные виды этого растения очень красивы в групповых посадках на фоне каменных валунов.

Молодило

Хвойные

Карликовые и стелющиеся хвойные растения для альпийской горки просто незаменимы. Ведь именно они помогут сохранить декоративность вашего альпинария в зимнее время года. Различные чудесные оттенки зеленой хвои создадут неподражаемый эффект. Кроме того, все эти виды очень медленно растут и не нарушат гармонию цветника.

Горная сосна Морs

Большое разнообразие карликовых видов у горной сосны (Pinus mugo). Чаще всего они имеют форму, приближающуюся к шарообразной. Отметим самые популярные сорта. Очень миниатюрные «Морs» и «Winter gold», эти сосны в десятилетнем возрасте имеют высоту около 50 см и 1 м ширину кроны, также они обе очень неприхотливы и прекрасно себя чувствуют в условиях альпинария. «Морs» имеет зеленовато-голубую хвою, а «Winter gold» летом ярко-зеленая, а зимой меняет окраску и становиться золотисто-желтой.

Чуть повыше ростом (достигают 2 м) шарообразный сорт «Gnom» с блестящими темно-зелеными иголочками и развесистый кустарник «Mughus».

Ель канадская Conica

Также еще большим количеством низкорослых видов радует ель. Чаще всего ель обыкновенная (Picea abies) представлена такими карликовыми сортами — шарообразным «Little Gem» (до 50 см), кустовым «Nidiformis» (до 1 м) и узкоконическим «Will’s Zwerg» (до 1,2 м).  У ландшафтных дизайнеров популярен сорт ели «Глаука Глобоза», хоть она и вырастает до 3 м, но происходит это крайне медленно. Ну а у ели канадской (Picea glauca) всем известен такой карликовый сорт, как «Conica», у этой елочки красивая плотная пирамидальная крона, однако она часто поражается паутинным клещом и склонна к ранневесенним ожогам. В последнее время у «Коники» появилось множество декоративных форм, таких как «Globe Laurin», «Alberta», «Gnom».

Любимые многими западные туи (Thuja occidentalis) также могут предложить низкорослые растения для альпинария. Необыкновенно оригинальный и устойчивый сорт «Тeddy» — плотный темно-зеленый шарик (30х40 см). Неприхотливая «Globosa» (до 1 м) требует стрижки, но ее чешуйчатая хвоя красиво меняет цвет, переходя все оттенки зеленого до коричневого. Красив «пушистый» шар «Golden Globe» (до 80 см), хвоя которого внутри куста всегда зеленая, а наружный оттенок меняется от золотисто-желтого до медного зимой. Стоит отметить еще такие сорта, как «Little Dorrit», «Rheingold», «Danica», «Globosa Compacta», «Hoseri».

Не обойдется альпийская горка без можжевельника. Самый популярный и неприхотливый вид — можжевельник казацкий (Juniperus sabina). Для украшения альпийской горки подходят такие его сорта, как душистый стелющийся «Blue Danube», куст сорта «Еrecta» напоминающий узкий фонтан (до 2 м), плотный сине-зеленый ковер образует «Rockery Gem», а пестрая стелющаяся «Variegata» очень декоративна за счет кремовых вкраплений в окраске хвои. У можжевельника горизонтального или распростертого (Juniperus horizontalis) отметим сорта «Andorra Compact» (40х100 см), его плоская пепельно-зеленая «подушка» с наступлением холодов приобретает слегка фиолетовый оттенок; серо-голубой «Blue Chip» (30х150 см) очень подходит для городских условий; сорт «Wiltoni» расползается по земле и образует густой пышный серебристо-голубой ковер, а кустики «Lime Glow» (40х150см) отличаются яркой желтой окраской.

Можжевельник Lime Glow

Из более редких растений для альпийских горок можно отметить карликовую пихту одноцветную (Аbies concolor Сompacta), плакучую карликовую форму лиственницы европейской (Lаrix decidua Repens), сорта кедрового стланика (Pinus pumila) «Glauca», «Nana», «Dwarf Blue», карликовые сорта кипарисовиков (Chamaecyparis), тис ягодный кустарниковый (Taxus baccata Repandens). Мир хвойных карликовых растений очень разнообразен, поэтому мы остановились лишь на некоторых из них.

Кустарники

Относительно крупные растения для альпийской горки представлены декоративными кустарниками. Основная проблема, связанная с этим видом растений — осеннее опадание листвы, создающее трудности в уходе за цветником. Поэтому желательно подобрать вечнозеленые сорта.
У барбарисов (Berberis) очень декоративны листва и ягоды, самшитолистный (Вuxifolia) вид имеет зимостойкий сорт «Nana», а вечнозеленый (Gagnepainii lanceifolia) — сорт «Klugowski».

Вечнозеленый барбарис

Кизильник (Cotoneaster) также является обладателем красивой листвы, имеет множество декоративных видов и сортов (кустарниковых и ползучих), в том числе полувечнозеленые — Даммера (С. Dammerii) и многоцветковый (С. Multiflorus).

Вереск обыкновенный (Calluna vulgaris) — низкорослый вечнозеленый кустарник достойно украсит ваш альпинарий. Существует около 50 сортов, среди которых можно выбрать подходящие как по внешнему виду, так и по срокам цветения. Например, розовый «Tib», белый «Velvet Fascination», лососевый «J.H.Hamilton», пурпурный «Dark Beauty», красный «Mazurka», фиолетовый «Marllen» будут цвести друг за другом, а некоторые сорта обладают еще и декоративными листьями («Amilto», «Jan Dehher», «Velvet Fascination»). Различаются сорта и по высоте.

Вереск обыкновенный Tib

Знакомая всем и любимая спирея (Spiraea) также имеет подходящие для альпийской горки виды — березолистная (S. betulifolia Pall), японская (S. Japonica), белоцветковая (S. Albiflora), Бумальда (S. Bumalda), низкая (S. Humilis), карликовая (S. Pumilionum). К сожалению, два последних вида встречаются редко.

Также нужно отметить и лапчатку кустарниковую (Potentilla fnuticosa). Этот кустик вырастает до 1 м, очень неприхотлив, длительно цветет. Это кремово-белая «Gilford Cream», желтая «Goldfinger», лимонная «Kobold», розовая «Pink Queen», белая «Abbotswood», красная «Red Robin», оранжевая «Hopley Orange» и еще много других разнообразных сортов.

Лапчатка кустарниковая Goldfinger

Также используются в альпинариях, но могут подмерзать, самшит, хеномелис японский, магония подуболистная.

Оформление ярусов

Особенностью такого цветника, как альпийская горка, является ее многоярусность. Традиционно выделяют три ступени. Каждая из которых предлагает растениям специфические условия. Поэтому важно разобраться, как правильно распределить растения для альпинария по ярусам.

Полезно будет почитать:

Верхний ярус

Вершина — самое солнечное, но в то же время самое засушливое место в альпинарии, которое к тому же продувается ветрами. Поэтому в верхней части цветника следует высаживать солнцелюбивые и засухоустойчивые растения. Такие условия будут привычными для цветущего летом горного жителя эдельвейса (только необходимо правильно подобрать ему грунт). Весной украсит вершину цветущими ковриками иберис, который может в конце лета расцвести повторно. Подойдут такие условия гвоздикам, которые тоже очень любят солнышко и будут радовать вас все лето. Также солнцелюбивы крупка (Draba), цветущая в начале лета, и кошачья лапка (Antennaria). Отличается завидной засухоустойчивостью неприхотливый тимьян. Его листочки весь теплый сезон будут создавать симпатичный коврик (особенно декоративен тимьян лимоннопахнущий), а летнее цветение окутает вершину горки изумительным ароматом.

Иберис
Тимьян

Молодило — засухоустойчивый многолетник, высадив его группами разных сортов, можно создать на весь сезон чудесную композицию. Из крупных растений хорошо будет чувствовать себя на вершине можжевельник казацкий.

Средний ярус

Здесь уже другие условия, более комфортные. Солнце и полутень сочетаются с умеренной влажностью грунта. Причем, в этом ярусе особенно различаются условия на разных сторонах горки. Например, южная сторона будет достаточно солнечной, а северная тенистой. Цветы для альпийской горки в этой зоне отличаются большим разнообразием. Весеннее цветение начнут луковичные и примулы. Яркие краски лета подарит флокс шиловидный. Более засушливая и солнечная сторона подойдет для очитка, льна и астры. А северный склон может занять арабис. Другие склоны украсят колокольчики, армерии, полынь, душица, декоративный лук, также стоит обратить внимание на брахикому, посадка и уход за которой не отличаются сложностью.
В полутени хорошо будут расти карликовые ели, кедровый стланник.

Нижний ярус

Ковыль (злак)

Подножие горы плавно переходит в основной сад. Здесь уже достаточно влаги. Растения для альпийской горки в нижнем ярусе следует размещать влаголюбивые и хорошо переносящие относительную затененность. Здесь замечательно разместятся листовые декоративные кустарники. А также некоторые хвойники, например, туя западная, тис ягодный, кипарисовик. Яркие краски обеспечат камнеломка, горечавка в сочетании со злаками, лесные виды хохлатки, некоторые виды лапчатки. Добавят предгорного колорита лютики и ягодные коврики дюшенеи.

Растения для горки с водоемом

Особый подход к подбору растений требуется, если ваша горка расположена у водоема. Растения для альпинария такого типа подбираются, как было рассмотрено выше, а вот для декорирования прибрежной зоны нужны исключительно влаголюбивые виды.

Возле крупных камней на берегу прекрасно будут смотреться ирис болотный (Iris pseudacorus), лобелия (Lobelia), папоротники, хосты. Очень хорошо переносят сильную влажность милые цветы губастика желтого (Mimulus), нежной незабудки болотной (Myosotis palustris), вероники горечавковой и порученной (Veronica gentianoides и beccabunga), мяты болотной (Mentha aquatica), лихниса кукушкин цвет (Lychnis flos-cuculi).

Губастик желтый
Лихнис кукушкин цвет

Прибрежную зону можно украсить низкорослыми астильбами, бузульником, вербейником точечным, ветренницей вергинской (Anemone virginiana), бруннерой (Вrunnera).

На мелководье прекрасно растет белокрыльник болотный (Calla palustris),

А саму водную гладь чудесно украсит и очистит эйхорния (Eichhornia), а также кувшинки и кубышки.

Любит влажный грунт и тень (но не застой воды) очень интересное хвойное растение — тсуга канадская (Tsuga canadensis).

Эйхорния
Тсуга канадская

В оформлении прибрежной зоны особенно важно соблюдать меру. Главной в этой композиции является каменная горка, поэтому не рекомендуется излишней яркостью водоема отвлекать от нее внимание.

Мы рассмотрели только некоторые популярные растения для альпийской горки. Из них вы сможете спланировать и составить чудесную композицию. А знания основных требований к ним и правил подбора помогут вам расширить предложенный список.

фото и названия растений для альпинария, многолетники для горки

Говоря о цветах для альпийской горки и цветах для альпинария, чаще всего имеют в виду одни и те же растения. Ведь создание каменистых садов – это искусство, поэтому ни о каких строгих правилах здесь речи идти не может. Чаще всего под обоими этими понятиями подразумевают одно и то же. Так какие же цветы подходят для альпийской горки и всех разновидностей садов такого рода? Ниже вы узнаете названия альпийских цветов, посмотреть их фотографии и сможете ознакомиться с условиями выращивания этих растений.

Какие цветы подходят для альпийской горки

Иберис, стенник (IBERIS). Семейство капустных (крестоцветных).

Около 40 видов растут в Южной Европе. У многолетников листья цельные, ланцетные, цветки белые в плотном соцветии.

Виды:

Иберис скальный (I. saxatiLis) — высота 15 см, кустик округлый.

Иберис вечнозеленый (I. sempervirens) — полукустарник, куст плотный, округлый, высотой 25-30 см.

Сорта:

«Snowflake»

«Nana»

«FindeL»

Условия выращивания. Солнечные участки с садовыми почвами и ограниченным увлажнением.

Размножение. Семенами (посев весной), сеянцы зацветают на второй год; стеблевыми черенками (после конца цветения). Плотность посадки — 16 шт. на 1 м2.

Кольник, фитеума (PHYTEUMA). Семейство колокольчиковых.

Кистекорневые многолетники с субальпийских лугов, лесных полян гор Средней Европы. Листья в прикорневой розетке, цветки мелкие, колокольчатые, в плотном конечном колосовидном соцветии, высота 30-40 см.

Виды и сорта:

Кольник черный (P. nigrum) — цветки очень темные.

Кольник колосистый (P. spicatum) — цветки беловатые.

Кольник Вагнера (P. vagneri) -цветки ярко-лиловые.

Условия выращивания. Полузатененные участки с рыхлыми нейтральными почвами.

Размножение. Семенами (посев весной), образуют самосев, делением куста (весной и в конце лета). Плотность посадки — 20 шт. на 1 м2.

Как видно на фото, эти цветы для альпийской горки используют в смешанных цветниках и рокариях.

Купена (POLYGONATUM). Семейство ландышевых (лилейных).

Крупный род (150 видов) лесных длиннокорневищных многолетников, образующих заросли в широколиственных лесах Евразии. Можно выделить две группы видов:

  • с прямостоячим стеблем, покрытым узкими ланцетными листьями с цветками в их пазухах;
  • стебли аркообразные с кожистыми овальными листьями и мелкими колокольчатыми цветками, свисающими из пазух листьев. Плод — красная ягода.

Виды и сорта:

Купена мутовчатая (P. verticillatum) — высотой до 80 см, леса Европы.

Купена розовая (P. roseum) — высотой 30 см из горных лесов Средней Азии.

Купена узколистная (P. stenophyllum) — высотой 40-50 см из лесов Дальнего Востока.

Условия выращивания. Все виды, кроме купены душистой (она может расти на солнечном участке), хорошо растут в тени и полутени, на рыхлых дренированных лесных почвах.

Размножение. Эти виды многолетников для горки размножают отрезками корневища с почкой возобновления, только в конце лета. Плотность посадки — 12 шт. на 1 м2.

Лапчатка (POTENTILLA). Семейство розоцветных.

Большой род (около 300 видов), включающий виды с разной экологией, но выращивают всего несколько видов и сортов многолетников с красивыми тройчатыми зимующими листьями и яркими цветками.

Виды и сорта:

Лапчатка белая (P. alba) — высотой 10 см, цветки белые, цветет раньше других видов (в начале мая).

Лапчатка плетевидная (P. flagellaris) — высотой 15 см, стебли ползучие, укореняющиеся, цветки желтые.

Лапчатка гибридная (P. х hybrida).

Лапчатка темно-кроваво-красная (P. atrosanguinea).

Лапчатка золотистая (P. aurea) — высотой 10 см.

Лапчатка непальская (P. nepalensis).

Сорт «Miss WiLLmott» — высотой 50 см, цветки розоватые с каемкой.

Лапчатка прямая (P. recta) — высотой 40 см, цветки желтые.

Сорта с яркими цветками:

«Gibson»s Scarlet»

«YeLLow Queen».

Условия выращивания. Солнечные участки с любыми почвами с умеренным увлажнением.

Размножение. Эти цветы-многолетники для альпийской горки размножают семенами (посев весной), сеянцы зацветают на 2-й год; делением куста (весной, в конце лета). Плотность посадки — 12-20 шт. на 1 м2.

Альпийские цветы-многолетники

Лен (LINUM). Семейство льновых.

Крупный род (около 250 видов), в основном распространенный в Средиземноморье. В качестве декоративных растений выращивают только несколько видов с изящными тонкими линейными листьями и ажурным кустом. Цветки желтые и голубые (у многолетних видов).

Виды и сорта:

Лен желтый (L. flavum).

Сорт «Compactum» — высотой 20 см, цветки желтые в метельчатом соцветии.

Лен многолетний (L. perenne) — с голубыми цветками.

Сорт «ALbum» — с белыми.

Условия выращивания. Эти растения для альпийской горки предпочитают солнечные участки с легкими плодородными почвами.

Размножение. Семенами (посев под зиму или весной), сеянцы зацветают на 2-й год. Делением куста (весной). Плотность посадки — 16 шт. на 1 м2.

Лихнис, зорька (LYCHNIS). Семейство гвоздичных.

Кустовые многолетники высотой 40–100 см, с плотной системой корней, многочисленными прямостоячими побегами, ланцетными листьями и крупными (4–5 см в диаметре) яркими цветками в щитковидном соцветии. Все растение опушено. В природе эти альпийские цветы широко произрастают на лугах и в степях умеренной зоны.

Виды и сорта:

Лихнис сверкающий (L. fulgens) – цветки огненнокрасные, теневынослив.

Лихнис халкедонский (L. chalcedonica) – высотой 100 см, цветки в щитковидном соцветии огненнокрасные.

Лихнис увенчанный (L. coronaria) — высотой 60 см.

Горицвет — цветки малиновые с цельным отгибом и серебристыми листьями.

Смолка (L. viscaria).

Сорт «PLena» — стебли клейкие, лепестки с цельным отгибом, малиновые.

Лихнис Хаге (L. x haageana) — гибрид с оранжево-красными цветками.

Лихнис кукушкин цвет (L. fioscucuii = Coronaria fioscucuii) -лепестки розовые с глубокораздельным отгибом.

Условия выращивания. Солнечные участки (кроме теневыносливого л. сверкающего). К почвам нетребовательны. Засухо- и морозоустойчивы.

Размножение. Семенами (посев весной), черенками (летом), делением куста (весной и в конце лета). Плотность посадки — 9-12 шт. на 1 м2.

Низкие виды в рокариях и бордюрах, высокие в миксбордерах и для срезки.

Многолетние цветы для альпийской горки

Молодило (SEMPERVIVUM). Семейство толстянковых.

Известно около 40 видов и десятки сортов. Родина — горы Средиземноморья. Красота растения в листьях (сочные, суккулентные, всех окрасок — от светло-зеленой до краснобурой, часто сизые), собранных в плотную розетку (диаметром 2-15 см), над которой поднимается цветонос со щитковидным соцветием из мелких недекоративных цветков. Многие молодило — монокарпики, т. е. отцветший экземпляр погибает, образовав массу розеток-деток.

Виды и сорта. Чаще всего выращивают гибридные формы (S. xhybridum) с листьями всех тонов и окрасок:

Молодило кавказское (S. caucasicum) — листья зеленые.

Молодило кровельное (S. tectorum) — листья зеленые, розетка крупная.

Молодило отпрысковое (S. soboliferum) — листья реснитчатые с красным кончиком.

Молодило паутинистое (S. arachnoideum) — самый эффектный вид с розеткой светло-зеленых загнутых листьев, покрытых белыми волосками, как паутиной.

Молодило шарообразное (S. globiferum) — листья заостренные опушенные.

Условия выращивания. Молодило — неприхотливое растение, особенно хорошо растет на солнечных участках с бедными песчаными или каменистыми почвами, обогащенными известью.

Размножение. Молоды ми розетками в течение сезона. Посаженные весной, они летом образуют многочисленные столоны с розеткой листьев на конце. Розетки укореняются, и через 2-3 года образуется сомкнутый покров. Плотность посадки — 25-30 шт. на 1 м2. Молодило легко гибридизирует, поэтому лучше его размножать вегетативно.

В рокарии или в виде небольших ковриков среди кустовых многолетников (лиатрис, гейхера, гайлардия и т. п.), по бордюру.

Нектароскордум (NECTAROSCORDUM). Семейство луковых.

Луковичное растение из тенистых лесов Южной ровидная крупная луковица, высокий стебель, заканчивающийся шаровидным зонтичным соцветием, крупные ширококолокольчатые цветки поникают. Листья широкие, светло-зеленые.

Виды и сорта:

Нектароскордум диоскорида (N. dioscoridis) — цветки зеленоватые с красными прожилками.

Нектароскордум трехфутовый (N. tripedaie) -цветки белые.

Условия выращивания. Тенистые участки с рыхлыми лесными почвами.

Размножение. Семенами (посев свежесобранными), луковицами-детками. Плотность посадки — единично.

Многолетники для альпинария

Овес (AVENA). Семейство мятликовых (злаковых).

Овес вечнозеленый (A. sempervirens) — плотнокустовый злак с узкими листьями, пониклыми колосками.

Наиболее декоративен сорт «PenduLa» — высокие (до 80 см) растения, пониклые метелки колосков.

Условия выращивания. Солнечные места с рыхлыми, хорошо дренированными щелочными почвами.

Размножение. Семенами (посев весной). Плотность посадки — единично.

Овсяница (FESTUCA). Семейство мятликовых (злаковых).

Многолетние корневищные злаки, растущие по лугам, лесам и степям всего мира. Листья узкие, образуют густой куст, соцветие — метелка.

Виды и сорта. Выращивают многочисленные виды, особенно в составе газонов, но в цветниках чаще всего используются:

Овсяница пепельно-серая (F. giauca).

Сорт «SiLberreiher» — высотой 25 см.

Овсяница аметистовая (F. amethystina).

Овсяница овечья (F. ovina).

Сорт «SoLLing» — сизоватые листья 25 см.

Условия выращивания. Солнечные участки с любыми, относительно сухими почвами.

Размножение. Семенами (посев под зиму) и делением куста (весной и в конце лета). Плотность посадки — 9 шт. на 1 м2.

Ожика (LUZULA). Семейство ситниковых.

Корневищные многолетники из лесов Европы. Листья злаковидные зимующие. Соцветие легкое, ажурное. Образуют кусты или заросли.

Виды и сорта:

Ожика волосистая (L. pilosa) — низкий (5-10 см) кустик с овальными листьями.

Ожика ожиковидная (L. luzuloides) — куст высотой 60-70 см, листья узкие, темнозеленые.

Ожика лесная (L. sylvatica) — заросль высотой 50-60 см из светло-зеленых широких листьев.

У сорта «Marginata» по краю белая полоска.

Ожика снежная (L. nivea) — высотой 30-45 см, с тонкими листьями.

Условия выращивания. Полузатененные и тенистые участки под пологом деревьев с лесными рыхлыми почвами и листовым опадом осенью.

Размножение. Семенами (посев весной), делением куста (весной и в конце лета). Образует самосев. Без деления и пересадки может расти до 20 лет. Плотность посадки — 9 шт. на 1 м2.

Подорожник (PLANTAGO). Семейство подорожниковых.

Подорожник большой (P. major) — стержнекорневой многолетник с овальными, прижатыми к земле листьями, у которых отчетливо выделяются жилки.

В цветоводстве используют два сорта:

«RosuLaris» с темно-зеленой розеткой листьев и соцветием — узкий колос, форма растения — пирамидальная, высота 23 см.

«RubrifoLia» — с темно-пурпурными листьями, высота 30 см.

Условия выращивания. Солнечные участки с бедными супесчаными или каменистыми почвами.

Размножение. Семенами (посев весной и осенью). Плотность посадки — 25 шт. на 1 м2.

Еще названия альпийских цветов-многолетников

Полеска, сцилла (SCILLA). Семейство гиацинтовых (лилейных).

Это мелколуковичные растения высотой 20-25 см, растущие в лесах Европы и Средиземноморья. Все, кроме п. осенней, цветут ранней весной, а в конце весны заканчивают вегетацию. Цветки — изящные, полураскрытые, в кистевидном соцветии, в основном голубые.

Виды:

Полеска осенняя (S. autumnalis) — цветки мелкие, синие.

Полеска двухлистная (S. bifolia) — 12-15 ярко-голубых цветков.

Полеска пушкиниевидная (S. puschkinioides) — цветки серо-голубые, раскрытые.

Полеска Розена (S. rosenii) — крупные сиреневые, с белым пятном в центре цветки, похожие на цикламен.

Полеска сибирская (S. sibirica) — встречается чаще других видов.

Сорта:

«Alba»

«Roseum».

Условия выращивания. Растут как в тени, так и на солнце. Но почва должна быть плодородной и рыхлой.

Размножение. Луковицами-детками, семенами (посев свежесобранными). Образует самосев. Плотность посадки — 40 шт. на 1 м2.

Прострел, сон-трава (PULSATILLA). Семейство лютиковых.

Травянистые многолетники (высотой 25-35 см) сухих лугов и степей Евразии. Корень толстый, глубокий, стержневой, поэтому растения не любят деления и пересадки. Листья разрезные, в прикорневой розетке, осенью становятся оранжево-красными. Цветки одиночные, крупные (5-7 см в диаметре), открытые, шелковистые от опушения, цветут весной.

Виды:

Прострел раскрытый (P. patens) — цветки фиолетовые.

Прострел красный (P. rubra) — цветки пониклые, фиолетово-красные.

Прострел весенний (P. vernalis) — цветки белые.

Прострел луговой (P. pratensis) — высота 20-30 см, цветки темно-фиолетовые.

Прострел обыкновенный (P. vulgaris) — цветки фиолетовые.

Сорта:

«Alba»

«Papageno» — высотой 15 см.

«Rubra» — цветки ярко-красные.

Условия выращивания. Солнечные участки с рыхлыми песчаными почвами, не переносят застоя влаги.

Размножение. Только семенами (посев под зиму), сеянцы зацветают на 2-й год.

Высаживать на место не старше 2 лет; на одном месте растут до 20 лет. Пересадку не любят. Плотность посадки -9 шт. на 1 м2.

Птицемлечник (ORNITHOGALUM). Семейство гиацинтовых (лилейных).

Виды и сорта. В средней полосе России наиболее перспективны:

Птицемлечник дугообразный (O. arcuatum) — из лесов Северного Кавказа.

Птицемлечник зонтичный (O. umbellatum) — леса Европы, высотой 10-25 см.

Птицемлечник пирамидальный (O. pyramidaLe) — высотой 55 см, незимостойкий.

Птицемлечник понтийский (O. ponticum = О. pyrenaicum) — леса Крыма, Кавказа, высотой 75 см.

Птицемлечник поникший (O. nutans) — высотой 35 см, полутенистые поляны Западной Европы.

Условия выращивания. Полузатененные участки под редким древесным ярусом, на богатых, хорошо дренированных лесных почвах. Обязательно сохранение на зиму листового опада деревьев.

Размножение. Луковицами-детками, семенами (их высевают осенью, сеянцы зацветают на 4-5-й год). Плотность посадки — 36 шт. на 1 м2.

Пузырница, физохлайна (PHYSOCHLAINA). Семейство пасленовых.

Пузырница физалисовая (P. physaloides) — длиннокорневищный весенне-цветущий многолетник с каменистых склонов гор Сибири и Дальнего Востока. Высота — 30 см, куст плотный, листья простые, опушенные, цветки в щитковидном соцветии, сиреневые. Эфемероид.

Условия выращивания. Открытые и полутенистые места с плодородными рыхлыми почвами.

Размножение. Отрезками корневищ с почкой возобновления после конца цветения. Плотность посадки -16 шт. на 1 м2.

Многолетние растения для альпинария

Пупавка (ANTHEMIS). Семейство астровых (сложноцветных).

Большой (около 200 видов) род, виды которого встречаются в Европе, Азии и Северной Африке. Кустики высотой 50-80 см из легких перисто-рассеченных листьев и цветоносов, несущих одиночные крупные желтые корзинки.

Виды и сорта:

Пупавка красильная, или желто-цветная (A. tinctoria) — листья крупные, сизо-зеленые.

Сорт «Kelwayi» высотой 70 см.

Пупавка горная (A. montana) — скальное, более низкое растение.

Пупавка Маршалла-Биберштейна (A. marschalliana) — высотой 25 см.

Условия выращивания. Солнечные места с нейтральными каменистыми почвами. На богатых почвах быстрее израстается и выпадает. Не переносит застойного увлажнения.

Размножение. Семенами (посев весной), сеянцы зацветают на 2-й год, и делением куста (весна и конец лета). Пересадка и деление через 2-3 года. Плотность посадки — 12 шт. на 1 м2.

Пушкиния (PUSCHKINIA). Семейство гиацинтовых (лилейных).

В роду два вида, растущих на горных лугах Кавказа и Турции. Это небольшие луковичные травы, цветущие ранней весной и теряющие листья в середине июня (эфемероиды). Цветки колокольчатые в плотном соцветии. Луковица образует по 2-4 цветоноса.

Виды и сорта:

Пушкиния гиацинтовидная (P. hyacinthoides) — с бледно-голубыми цветками в плотном соцветии из 12-15 цветков и ланцетными мясистыми листьями, по средней жилке цветка выделяется ярко-голубая полоска.

Пушкиния пролесковидная (P. scilloides) — отличается более рыхлым соцветием из голубых цветков с синей полоской, цветет несколько раньше.

Условия выращивания. Солнечные места с плодородными, не переувлажненными произвесткованными почвами.

Размножение. Семенами (посев под зиму) и луковицами. Пересаживают через 5-7 лет, когда разрастаются «гнезда» луковиц. Плотность посадки — 25 шт. на 1 м2.

Равноплодник (ISOPYRUM). Семейство лютиковых.

Равноплодник василистниковый (I. thalictroides) — длиннокорневищный весеннецветущий многолетник из лесов Карпат. Изящные мелкие цветки покрывают землю сплошным ковром, подчеркивая красоту сизоватых листьев.

Условия выращивания. Тенистые участки под пологом деревьев на хорошо дренированных почвах.

Размножение. Отрезками корневища с почкой возобновления после конца цветения. Плотность посадки — 25 шт. на 1 м2.

Рябчик, фритиллярия (FRITILLARIA). Семейство лилейных.

В роду насчитывают около 100 видов луковичных многолетников, но в средней полосе России перспективны для выращивания всего несколько представителей этого рода, так как они очень требовательны к почвам, плохо противостоят сорнякам, а в средней полосе России часто выпревают поздней осенью или ранней весной.

Виды и сорта:

Рябчик камчатский (F. camschatcensis) — высотой 25-30 см, растение лесных полян Камчатки с мутовкой широколанцетных листьев и небольшим, кирпичной окраски цветком, хорошо растет в полутени.

Рябчик бледно-цветковый (F. pallidifbra) — растение Средней Азии, высотой 25-30 см, с бледно-желтыми цветками.

Рябчик императорский (F. imperialis) — родом из Афганистана, наиболее крупный рябчик (высота 60-100 см) с зонтиковидным соцветием из крупных оранжево-коричневых колокольчатых цветков (4-8 см), над соцветием возвышается пучок зеленых листьев.

Рябчик русский (F. ruthenica) — высотой 20-40 см, цветки темно-свекольные, крапчатые.

Рябчик шахматный (F. meleagris) — высотой 30 см, цветки темно-бордовые со светлыми пятнами, одиночные.

Рябчик шахматовидный (F. meLeagroides) — высотой 25-35 см, цветки мелкие (3 см), темно-красные, стебли поникающие — оба влаголюбивые виды.

Последние три вида — растения пойменных лугов южной России и вполне устойчивы в культуре.

Условия выращивания. Солнечные участки с богатыми, хорошо дренированными почвами.

Размножение. Семенами (посев под зиму), сеянцы зацветают на 3-4-й год, и луковицами, «гнезда» делят раз в 4-5 лет. Плотность посадки 5-12 шт. на 1 м2.

Посмотрите на фото этих альпийских цветов:

Высокие рябчики украсят любую смешанную клумбу, низкие — высаживают в рокариях.

Смолевка (SILENE). Семейство гвоздичных.

Около 400 видов этого рода растут в умеренной зоне Северного полушария, но в основном в Средиземноморье. Из многолетников в культуре широко выращивают около десятка видов, со скальных местообитаний, с «подушкой» из побегов с серебристыми листьями и стержневым корнем. Цветут все лето.

Виды и сорта:

Смолевка бесстебельная (S. acauLis) – высотой 5-8 см, листья узкие, цветки мелкие.

Смолевка валлийская (S. vaLLe-sia) — высотой 15 см.

Смолевка Шафта (S. schafta) — со скал Кавказа, высотой 10 см, крупные (3 см), темно-розовые цветки

Смолевка приморская (S. maritima) — высотой 15 см.

Сорт « Rosea» — цветки розовые.

Сорт «Weisskehlchen» — цветки белые.

Условия выращивания. Солнечные участки с рыхлой плодородной, достаточно увлажненной почвой. Хорошо растет в условиях влажного воздуха и почвы, без перегрева и застойного увлажнения.

Размножение. Семенами (посев весной), сеянцы зацветают на 2-й год. Сажать сразу на место (пересадку не любит) летними черенками. Плотность посадки — единично среди камней или 16 шт. на 1 м2 — для создания ковра в гравийном саду.

Другие цветы-многолетники для альпинария

Солнцецвет (HELIANTHEMUM). Семейство ладанниковых.

Полукустарнички из теплых сухих регионов. Вечнозеленые, с серовато-зелеными ланцетными листьями, обильно и длительно цветущие, образующие эффектные «подушки», они широко культивируются и имеют много сортов. Название этих цветов для альпийской горки говорит само за себя – солнцецветы предпочитают тепло, свет и солнце.

Виды:

Солнцецвет апеннинский (H. apenninum) — цветки желтые.

Солнцецвет гибридный (H. x hybridum) — результат скрещивания с. апеннинского и с. монетолистного, листья овальные, окраска цветков разнообразная.

Сорта:

«Braungold»

«Cerise Queen»

«Gelbe Perle»

«Pink Double»

«Rubin».

Условия выращивания. Солнечные участки с богатыми, рыхлыми, обогащенными известью почвами.

Размножение. Семенами (посев весной) и черенками (после конца цветения). Плотность посадки -12 шт. на 1 м5.

Сольданелла (SOLDANELLA). Семейство первоцветных.

Небольшие (5-15 см) растеньица с высокогорий Европы. Короткое небольшое корневище, прикорневая розетка округлых кожистых листьев и колокольчатые цветки с бахромчатыми по краю лепестками придают растению неповторимое изящество. Цветут рано весной.

Виды и сорта:

Сольданелла альпийская (S. alpina) цветет в конце апреля.

Сольданелла горная (S. montana) цветет в конце мая.

Условия выращивания. Слегка затененные места с хорошо дренированной кислой почвой с добавлением еловой хвои, прелого листа.

Размножение. Семенами (посев под зиму), сеянцы зацветают на 2-3-й год, делением куста (конец августа). Плотность посадки — 16 шт. на 1 м2.

Спаржа, аспарагус (ASPARAGUS). Семейство спаржевых (лилейных).

Спаржа ложно-шероховатая (A. pseudoscaber) — спаржу культивируют более 2000 лет как овощное, лекарственное и декоративное растение. Крупное растение (высота до 170 см) с мощным коротким корневищем, глубокой корневой системой.

Многочисленные крепкие стебли образуют куртину. Они покрыты многочисленными чешуйками, в пазухах которых располагаются игольчатые, нежно-зеленые веточки, имитирующие листья. Цветки мелкие, беловато-зеленые, недекоративные. Спаржа эффектна в период плодоношения, когда созревают многочисленные ярко-красные плоды-ягоды.

Сорт «Spitzenschelier» -высотой 80 см.

Условия выращивания. Солнечные или полузатененные участки с плодородными почвами.

Размножение. Делением куста (весной или в конце лета), семенами (посев под зиму). Длительно (до 20-25 лет) живет без пересадки и деления. Плотность посадки -3 шт. на 1 м2.

Щучка, луговик (DESCHAMPSIA). Семейство мятликовых (злаковых).

Щучка дернистая (D. caespitosa) — многолетний злак с влажных лугов Европы и Азии. Образует плотную кочку (плотнокустовый) из узких, жестких, с острыми краями листьев. Листья зимующие темно-зеленые. В июне-июле появляются плотные метелки высотой 40-60 см.

Сорта:

«Goldschleier» — с золотистыми листьями.

«Tautrager» -листья с белой полоской.

Условия выращивания. Солнечные места с влажными почвами, переносит застой влаги.

Размножение. Семенами (посев весной), молодые кусты можно делить (весной и в конце лета). Старые кусты плохо делятся. Плотность посадки — 5 шт. на 1 м2.

Мителла (MITELLA). Семейство камнеломковых.

Низкие (8-20 см) многолетние травы с длинным тонким корневищем, образуют заросли; стебли ползучие волосистые; листья сердцевидные прикорневые. Цветки красновато-коричневые.

Виды и сорта:

Мителла голая (M. nuda) — из хвойных лесов Сибири.

Мителла двулистная (М. diphylla) — из лесов Северной Америки.

Условия выращивания. Тенистые участки с рыхлыми почвами.

Размножение. Делением куста и отрезками корневищ ранней весной и в конце лета. Плотность посадки — 20 шт. на 1 м2.

Многолетние цветы для альпийской горки

Пышное цветение однолетних цветов восхищает, но на альпийских горках предпочтительнее высаживать многолетние цветы и травы не выше 30 см. Существует целый ряд причин в пользу низкорослых многолетников. Главная из них – образование густых куртин (зарослей), которые придают альпийской горке неповторимый вид. Яркие пятна куртин в период цветения создают подобие лоскутного одеяла. Пестрота огибает кривую поверхность – эффект присущий только альпинарию.

Какие цветы выбрать для ал

За многолетними цветами легче ухаживать: труднодоступные для прополки расселины юркие многолетники забивают своими корнями и стеблями. Семена сорняков в тени куртин погибают. Многолетние заросли в точности повторяют мозаику уложенного камня, возникает рисунок в виде паутинки. Со временем многостебельные кустики цветущих многолетников обвивают собой всю поверхность: так мелкие соцветия защищают пыльники от загрязнения. Многие альпийские растения опыляются без участия насекомых. Именно по этой причине у альпийских растений преимущественно простые соцветия. Ландшафтные дизайнеры ценят многолетники за плотность соцветий и длительность цветения: от 1,5 до 2,5 месяцев.

Важным фактором есть то обстоятельство, что многолетние цветы альпинариев не требуют большой массы гумуса. Развитие альпийских трав происходит преимущественно за счет фотосинтеза. Они не переносят тень. Под каменными россыпями альпинария закладывают дренажный слой из песка и щебня: застой влаги в корневой системе приводит к загниванию корневой системы.

Цветы для альпийской горки могут переносить засухи. Однако для обильного цветения требуют систематического полива: один раз в неделю. Перед раскрытием бутонов на увлажненные куртины выливают раствор нитроамофоса. Вносят удобрения и на отцветшие растения. После цветения делают точно так же, как в первом случае: с предварительным увлажнением почвы.

Особенностью многих альпийских трав является их повторное цветение в конце лета. Чтобы увидеть цветущую альпийскую горку еще раз, необходимо состричь семенные коробочки.

Большинство многолетних цветов для альпийских горок легко переносят морозы, но сильно приминаются снежными наметами. С целью сохранения пышности зарослей, альпийские горки укрывают на зиму лапником, дополнительно укрывают полиэтиленовой  пленкой или садовым нетканым холстом.

Старая загустевшая куртина плохо вентилируется, в ней накапливается влага, заводится плесень. Повреждения наблюдаются в 5 - 6 –тилетних куртинах. Кустики старых трав удаляют, а отводки пересаживают на новое место. Кроме плесени, у альпийских трав существует еще две болезни: пятнистая ржавчина (источник – сухие листья буковых деревьев) и вирусные заболевания (проникают из не слежавшегося перегноя). При соблюдении режима посадки и ухода многолетние альпийские травы не утрачивают жизнеспособность на протяжении многих лет.

Многолетние цветы для альпийских горок хорошо всходят из прошлогодних семян. За 1,5 – 2 месяца до высадки сеянец выращивают в лотке с листовой землей. В летнее время саженец можно вырастить из стебля в емкости с водой, спрятав от попадания прямых солнечных лучей. В течение 20 дней на срезе появляются белые корешки. Саженец перед высадкой в открытый грунт подращивают в обогащенной смеси на протяжении двух  недель. Намного быстрее вырастить кустик из отводка. Длинный стебель с корнем подращивают в грунте, каждый день поливают.

Многолетним цветам для альпийской горки иногда дают замысловатые названия, хотя семейство цветущих альпийских растений насчитывает не более 20 основных видов (для умеренных широт). Все необъятное многообразие предлагаемых  цветов достигнуто селекционной работой. Скрещены высокорослые сорта с низкими. Добавлены метельчатые формы. Часто один и тот же сорт называют по-разному. Пример тому – гвоздика шиловидная. В продаже ее могут предложить как «игольчатую».  В названиях карликовой гвоздики для альпинариев отражено селекционное скрещивания турецкой бородатой гвоздики (Dianthus barbatus) с низкорослой сибирской (Dianthus acicularis Fisch. ex Link).  В названии сорта может быть отражен и первый, и второй источник. Другой пример – многоликость тимьяна. Кроме различий в форме соцветий  сортовых тимьянов и дикорастущих, отмечается разнообразие в листовой части. Выведены тимьяны с мелкими, укрупненными, с обводками по краю, желтыми, оранжевыми листьями. Существуют даже опушенные тимьяны. Полное ботаническое название включает название вида, место произрастания в природе и название сорта, данное автором-селекционером. Изначально скудная альпийская растительность спустилась с гор в сады и видоизменилась до неузнаваемости.

Фото и названия цветов для альпийской горки

Обриета

Наиболее популярный многолетник для альпийской горки –  обриета (Aubrieta Adans). Капустный крестоцвет. Произрастает в горах Ближнего Востока и на Балканах. Другое название – обриеция. Цветет розовым, фиолетовым, синим или красным плотным  ковром. После цветения поросль превращается в подобие увядшего мха. Во избежание неряшливого вида на альпинарии, обриету стригут, и так принуждают ее цвести повторно.

Гвоздика

Гвоздика перистая (Diantus plumaris) – ароматный гибрид с сильнорассеченными лепестками.  Сорт Albus – белоцветущий.  Сортосмесь «Рой бабочек», полученная в результате скрещивания гвоздики пышной европейской и криволинейной песчаной, узнаваема по лепесткам в виде усиков мотыльков. Включает оранжевые, лиловые, двухцветные сорта. Гвоздика перистая метельчатая (Венгерская) используется в качестве культурного растения с дохристианских времен. Соцветия густые, до 3 см в диаметре. Цветет красным, пурпурным, розовым. Существуют сиреневые, серовато-голубые сорта. Сибирские гвоздики можно узнать по стройным стеблям и собранным в колокольчики соцветиям. Ценятся за насыщенный рубиновый цвет.

Бегония вечноцветущая

Begonia semperflorens – растение с зелеными, сребристо-коричневыми или пурпурными листьями. Тычинки собраны в плотную шарообразную кисточку. Найденные на Антильских островах в конце XVII века виды поразили европейских ботаников своим разнообразием. Однако любая бегония зимует только в отапливаемом помещении. В средине зимы растение чахнет и наземная часть погибает. Однако подземная весной возрождается вновь. Для альпийских горок используют стланиковые не клубневые сорта. То, что ошибочно считается лепестками бегонии, на самом деле сверхразвитые чашелистики. Лепестков у бегонии вечноцветущих нет. Однако разнообразие окраски чашелистиков – от белого до карминового – способствует активному использованию бегоний для украшения альпийских горок.

Делосперма

Родина этого удивительного растения – Северная Африка. Но выведены многолетние сорта, выдерживающие без укрытия - 17°. Delosperma congestum засцветает желтым плотным ковром в конце мая. Цветы многолепестковые, напоминают маргаритки. В центре – венчик изящных нежных пыльников. На старых кустиках листва приобретает бордовый оттенок. Существуют малиновые сорта, сиреневые, двухцветные и с ассиметричным соцветием в виде хризантемы. Во избежание выветривания зимой делосперму укрывают садовым холстом.

Медуница бурачниковая

Pulmоnaria – латинское название медуницы. Известны ее лекарственные растения. Цветет весной колокольчиками синего, фиолетового или малинового цвета. На одном стебле рядом с голубыми, более молодыми соцветиями, одновременно находятся более старые – с фиолетовым оттенком.  Существуют белоцветковые сорта. После цветения у некоторых сортов медуницы листья покрываются белыми пятнами. Особенно декоративны сорта с голубой листвой.

Глобулярия

Отличное растение для альпийских горок из рода подорожников. Названо так за компактные в виде шаров соцветия – белые, синие, сиреневые. В природе встречается редко, внесено в Красную книгу. Различают волосоцветковую г. с соцветием, похожим на василек, волоцветковую, названную за лепестки в виде лунок, серцевиднолистную и точечную – с множеством маленьких лепестков. Для альпинария лучше всего подходят ползучие сорта глобулярии.
Камнеломка

Распространено другое название этого растения: Саксифрага (неправильное прочтение двух слов: saxum – камень и frango – ломать). Камнеломку легко спутать с обриетой, если рассматривать с далекого расстояния. Но вблизи видны характерные штришки на лепестках. На сорте aureopunctata хорошо различимы пятнышки. Для умеренных широт наиболее пригодна камнеломка Арендса. Восточные и северные стороны заполняют теневыносливым сортом S. umbrosa L. Существует метельчатые и карликовые формы. Камнеломки высаживают вдали от других альпийских растений. Рост камнеломок настолько активный, что все остальное на альпийской горке может быть вытеснено. Экспансию камнеломок сдерживают подрезкой отводов.

Арабис (Резуха)

Одно из лучших растений для альпийских горок. Летом в полдень предпочитает тень. Посадка – «букетная». В одну лунку сажают по несколько черенков. Белые, малиновые или карминовые цветы распускаются в мае. Медоносное растение, привлекает пчел, насыщенным ароматом. Белые сорта зимой подмерзают, но быстро восстанавливаются из корня. Существует метельчатые гибриды Арабиса. Гибридные формы утрачивают особенности при возобновлении семенами, поэтому их размножают черенкованием. Так же, как и камнеломка, активно вытесняет все вблизи растущее, поэтому отводки арабиса необходимо срезать. В новых сортах видоизменены листья: А. Фердинанда – с серо-голубыми листьями в белых кантах; A. Proccurens «old gold» – с полосатыми листьями цвета хаки; A. Variegata – с зазубринами по белому канту. После цветения семенные коробочки удаляют. Сеянцы начинают цвести через год.

Вероника

Распространенное растения во всех частях света, вплоть до Антарктиды. Узнаваемо по трубчатым опушенным стеблям и грубоватым в лоске листьям. Активный самосев. Любит тень и увлажненную почву (народное название – «крыничник»). Излюбленное растение в садоводстве благодаря изящному конусовидныому цветку с длинными тычинками. Стелющийся вид способен поглотить за несколько сезонов весь сад. Новые сорта выведены благодаря скрещиванию с австралийскими видами. Характерный признак вероники для альпинария – одеревеневший изогнутый стебель. Цвет – насыщенный ультрамариновый. В новых сортах культивируются широкие лепестки. Сорт «Нестор» расцветает небесно-синим, деревянистая вероника похожа цветами на сиреневую с белой обводкой виолу. Нитиевидная вероника славится сложным многоцветием. Вероника Blue Indigo похожа на соцветия люпина, но более компактные.

Армерия

Это растение легко спутать с декоративными луками, но растет оно на изящной дернинке, стебель не превышает 15см. Из одного куста выпускает по 3-10 собранных в шар соцветий розового или белого цвета. Цветет на протяжении всего лета. Старые соцветия следует удалять. Легко размножается делением кустов.

Анациклус

У этого растения большое сходство с ромашкой маргариткой и укропом – одновременно. Белое многолепестковое соцветие окружают сильнорассеченные нежные листья. Но снизу лепестки у Анациклуса окрашены в бордовый цвет.
Специально для альпийских горок выведены новые сорта Барвинка, многолетней Герани, флокса шиловидного. Традиционно высаживается Лаванда.

Растения для альпийской горки - Клумбы и ландшафтный дизайн

Сегодня сложно представить современный сад без альпийской горки. Именно альпийская горка (или другое её название — альпинарий), придаёт саду оригинальность, завершённость, и где это необходимо, ощущение изменившегося ландшафта. Всё это создаётся благодаря удачному сочетанию декоративных растений, цветов, деревьев и камней.

Содержание:

 

На первом этапе создания альпийской горки следует определить месторасположение и возможный декор. Далее вам понадобятся каменные валуны различных размеров и формы, выбранные на ваше усмотрение.

Также, для изменения уровня горки следует подготовить дренаж, который ложится в самый центр. В качестве дренажа можно использовать и специальные материалы, и обычные опавшие листья и мелкие веточки. Сверху дренаж засыпается грунтом и декорируется валунами и камнями так, как вам больше всего нравится.

Главное, не забывайте: и земля и дренаж осядут, поэтому высота самой альпийской горки станет ниже, чем была при закладке.

После того, как горка готова, начинается процесс ее «заселения». Тут уж ваша фантазия не должна ограничиваться абсолютно ничем. Богатство флоры на сегодняшний день достигло своего апогея, поэтому сложностей с выбором растений для горки у вас не возникнет.

Хорошим дополнением к альпийской горке могут стать дорожки, вымощенные плоскими камнями, гипсовые скульптуры и тому подобное. Однако, если вы запланировали устроить в альпийской горке декоративный пруд или небольшой водопад, напоминающий природную горную реку в миниатюре, то без совета специалиста вам не обойтись.

Причем идти за советом следует во время планирования горки, а не после ее завершения, иначе придется разрушить часть вашего же труда. Конечно, если вы создали горку уже давно, а теперь решили дополнить ее журчащей водой – это другое дело.

Растения для альпийской горки

Для того чтобы альпийская горка соответствовала своему предназначению, её необходимо сооружать с учётом определённых правил. Не каждое растение подойдёт для альпинария, поэтому необходим тщательный отбор, учитывающий сроки зацветания растений, возможность или недопустимость совместного соседства, продолжительность цветения и многие другие факторы.

Если все условия посадки будут выполнены правильно, то альпийская горка будет радовать красивым и роскошным цветением всё лето, а, возможно, и осень.

Чтобы это произошло, необходимо для засаживания горки выбирать те растения, которые начинают цвести поочерёдно. Благодаря этому альпинарий постоянно будет видоизменяться и иметь живописный и ухоженный вид.

Для создания альпийских горок выбирают по большей части низкорослые растения. Это, например, лапчатка, сальвия, низкорастущие сорта настурции, спирея, маргаритки, примулы и многие другие.

Кроме того, на горку высаживают медленно растущие древовидные или опять же низкорослые хвойные экземпляры, но для создания акцентов добавляют пару-тройку крупных растений или кустарников.

Чтобы альпийская горка смогла стать украшение сада не только летом, но и зимой, среди растений должны фигурировать хвойные виды. Для этого хорошо подойдут можжевельник и карликовая сосна.

Помимо декоративных растений, на альпийской горке можно посадить и лекарственные травы, тогда она станет ещё и домашним лекарем. Для этого очень хорошо подойдут, к примеру, чабрец, розмарин, ромашка, шалфей и другие подобные растения.

Ко всему прочему, перед посадкой, необходимо учесть и стороны света. Делается это для того, чтобы все виды растений смогли хорошо укорениться и набрать силу, поскольку некоторые из них, в силу того, что им необходимо значительное количество солнечного света, предпочитают расти только на южной стороне.

Неприхотливые или тенелюбивые растения хорошо произрастают и на северных участках альпинария. А такие цветы, как колокольчики, крокусы и хризантемы, и вовсе прекрасно приживаются везде.

Таким образом, если приложить совсем немного усилий и соблюсти все вышеперечисленные рекомендации, то можно создать в своём саду настоящее творение.

Какие нужны растения для альпинария?

Сооружая альпинарий на территории собственными силами, очень важно знать как правильно и удачно выбрать растения, которые будут не только прекрасно выглядеть, но и долгое время радовать своим цветением. Насаждения должны быть не только разнообразными, но и хорошо приспособленными к климатическим условиям дачного участка.

Подбирая растения для клумбы, не следует обделять вниманием ковровые и низкорослые насаждения, которые станут основой и фоном готового альпинария.

При выборе зеленых насаждений обязательно следует учитывать погодные и климатические условия, которым подвержен участок, где будет располагаться альпийская горка. Растениям должно хватать солнечного света, влаги, тепла и удобрений.

Также очень важно обращать внимание на интенсивность разрастания и ветвления насаждений, поскольку это может испортить внешний вид и цветение альпийской горки. Насаждения должны гармонизировать между собой по размеру, цвету, скорости роста, времени цветения.

Поскольку альпинарий сооружается на долгий срок, подбирать растения следует как однолетние, так и многолетние. Прежде всего необходимо позаботиться о высадке почвопокровных растений, которые помогут плотно устелить поверхность земли.

Ландшафтные дизайнеры рекомендуют при выборе растений для альпинария учитывать величину и расцветку валунов, которые будут создавать основу декоративного объекта. Чтобы альпинарий выглядел гармонично и не перегружено, камни следует укладывать асимметрично и неплотно. Заполнить голые промежутки между ними можно низкорослыми насаждениями.

Кроме этого растения следует высаживать ярусами, верхушкой должны являться наиболее высокие и пышные виды, при этом с каждым последующим кругом, высота и размер насаждений следует уменьшать. Чтобы альпинарий функционировал круглый год, горку можно украсить хвойными и вечнозелеными насаждениями.

Многолетние растения для альпийской горки — фото и названия

Для того, чтобы было легче выбрать растения для альпийской горки, представляем вам самые популярные с названиями на двух языках и фото.

Анемона — Anemone

Алиссум скальный — Alyssum-saxsatile

Алиссум белый

Бадан — Bergenia

Барвинок травянистый — Vinca-herbacea

Бархатцы — Tagetes

Белое совершенство — Мальва мускусная — Malva moschata

Василёк горный — Centaurea montana

Вероника — Veronica

Вербейник монетчатый — Lysimachia nummularia

Гвоздика — Dianthus

Гвоздика низкорослая

Герань — Geranium

Дербенник иволистный — Lythrum salicaria

Дицентра — Dicentra

Живучка — Ajuga

Живучка ползучая

Зверобой — Hypericum

Ирис — Iris

Камнеломка круглолистная — Saxifraga rotundifolia

Котовник — Nepeta

Лаванда узколистная — Lavandula angustifolia

Лапчатка — Potentilla

Лапчатка непальская — Potentilla nepalensis

Люпин — Lupinus

Молодило — Sempervivum

Молочай — Euphorbia

Молочай окаймленный (невеста)

Пион — Paeonia

Портулак огородный — Portulaca oleracea

Разноцветный портулак на альпийской горке

Примула — Primula

Рудбекия — Rudbeckia

Седум — Sedum

Синеголовник аметистовый — Eryngium amethystinum

Синеголовник аметистовый

Сон-трава — Pulsatilla

Сон-трава

Тысячелистник — Achillea

Тимьян — Thymus

Фиалка — Viola

Флокс шиловидный — Phlox subulata

Флокс шиловидный

Чистец -Stachys byzantina

Энотера миссурийская — Oenothera missouriensis

Ясколка — Cerastium

Ясколка

Многие обладатели приусадебных участков знают, насколько важно содержать свою территорию в порядке и чистоте. Каждый старается привнести туда немного ярких красок и зелени, которые преобразят скромный ландшафтный дизайн.

Отличным декоративным объектом является альпийская горка, которая представляет собой нагромождение камней и растений, которые могут стать настоящим предметом гордости и украшения любого участка.

Что такое альпийская горка и какие растения подходят для нее — мнение эксперта

Про все весенние цветы читайте здесь.

Растения для альпийской горки: фото и названия

Сооружение альпинария — это возможность внести частичку горного ландшафта на свой равнинный участок земли. Сочетание грубых камней и нежных цветов оказывает завораживающее действие. Сегодня на нашем сайте о фермерстве мы рассмотрим, какие стоит использовать растения для альпийской горки — фото и названия. Вначале рассмотрим основные принципы подбора флоры для этого каменистого цветника.

Принципы подбора растений для альпийской горки

Создавая клумбу своими руками важно подобрать такие растения, которые будут гармонировать друг с другом и хорошо уживаться рядом. Для альпинария подойдут представители флоры, обладающие такими характеристиками:

  • Неприхотливость. Это важно, так как среди камней способны расти не все декоративные растения. Кроме того, если некоторые из растений будут нуждаться в частом и обильном поливе, то от этого могут пострадать остальные, составляющие основу горного ландшафта.
  • Компактность. Огромные цветы и кусты для альпийской горки не подойдут, так как скроют основную композицию. Речь не идет о том, что все растения должны быть одинаковыми, но слишком габаритных следует избегать.
  • Медленный рост. Не стоит сажать в альпинарий кусты, цветы и травы, названия которых входят в список быстро разрастающихся растений (яскола, седум). В этом случае эти растения могут вытеснить остальные, что убьет основную задумку.
  • Соответствие региону. Как бы не хотелось кому-то посадить на своем альпинарии эксклюзивное декоративное растение, делать этого нет смысла, если климат этой местности ему не подходит. Это приведет лишь к тому, что место на клумбе в итоге будет пустовать.

Интересно! Подобрав для альпийской горки цветы с разным периодом цветения, вы можете обеспечить красоту цветника на протяжении всего сезона.

На фото грамотно оформленная альпийская горка

Читайте также: Гортензия крупнолистная: посадка и уход в открытом грунте

Многолетники для альпийской горки: фото с названиями

Ниже мы подобрали для вас многочисленные фото растений, идеально подходящих для альпинария. Основу такой клумбы должны составлять многолетники. Обратите внимание на размещенные фото с изображением наиболее подходящих для данного вида цветника многолетними растениями.

Иберис


Эдельвейс

На фото эдельвейс — символ гор

Кольник


Купена


Лапчатка


Лен

Лихнис

Молодило

На фото молодило — частый житель альпийских горок

Овес вечнозеленый


Овсяница


Подорожник

Подорожник — знакомое с детства название растения, которое часто встречается в альпинариях

Полеска


Прострел


Птицемлечник


Пузырница


Пупавка

Пушкиния

На фото очаровательный цветок пушкиния

Рябчик


Смолевка


Солнцецвет


Сольданелла


Камнеломка

Камнеломка — название растение получило из-за способности активно развиваться среди камней

Хохлатка


Безвременник


Манжетки


Флоксы


Эхинацея


Гвоздика

На фото миниатюрные гвоздики для альпийской горки

Крокус


Мускари


Барвинок


Гиацинт


Тимьян

На фото известное в роли специи растение — тимьян

Низкорослые тюльпаны и нарциссы

Однолетние растения для альпинария: фото и названия

Однолетние растения в оформлении альпийских горок используются редко — в основном для заполнения пустот, где со временем должны разрастись многолетники. Можно использовать самые обычные светолюбивые и не слишком требовательные к влаге растения.

Бархатцы


Зайцехвост


Брахикома


Лобелия


Агератум

Лиственные и хвойные кустарники: фото и названия

Небольшие симпатичные кустики также могут стать частью альпийской горки, но при одном условии — их не должно быть много. Всего несколько штук достаточно для расстановки акцентов. Что подойдет?

Барбарис


Кизильник

Растение под названием кизильник выгодно дополняет оформление альпинария

Спирея


Хеномелес

Высота хвойных кустарников для альпинария не должна превышать 70 см, только на очень крупной каменистой горке можно посадить хвойное растение до 1,5 м. Их лучше всего сажать у подножия горки. Представители группы хвойных растений обеспечат эстетику вашей клумбы даже в зимнее время.

Пихта


Можжевельник

На фото можевельник

Ель сизая


Сосна горная


Туя западная


Лапчатка кустарниковая

Советы по обустройству альпинария

Верхний ярус. Здесь необходимо сажать растения, которые особенно любят солнце и засуху, а также спокойно переносят ветра. Например, подойдет эдельвейс, иберис, гвоздики, тимьян, молодило, можжевельник.

Средний ярус. Здесь выбор растений очень широк, так как это место умеренно освещено солнцем и не слишком засушливо. Важно учитывать, что с южной стороны горки условия значительно отличаются от условий с севера.

Нижний ярус. В этом месте лучше сажать растения, любящие затенение и повышенную влажность. Например, хорошо подойдут хвойные кустарники, камнеломка, хохлатка, лапчатка.

Важные напоминания:

  • Необходимо учитывать, что некоторые виды камней, которые часто используют для устройства альпийской горки могут влиять на состав грунта, например, повышать его кислотность.
  • В центре альпинария обязательно должен быть дренажный слой. Для него можно использовать небольшие веточки или камешки.
  • Следует учитывать и такой момент: возле мелких камней нельзя высаживать крупные растения.
  • Многие лекарственные растения — ромашка, шалфей, розмарин, чабрец — отлично растут в условиях горного ландшафта, поэтому вы можете засадить ими определенный участок альпинария и тем самым использовать его не только для красоты, но и пользы для тела.
  • Чтобы альпинарий выглядел естественно и был похож на фрагмент реального горного ландшафта, камни не следует выкладывать симметрично.

Для того, чтобы альпинарии выглядел наиболее естественно, важно выбрать один стиль оформления и следовать ему. О чем речь? Например, создавая альпинарий в виде скалы, крупные валуны кладут у основания горки, а мелкие и средние по всей ее поверхности. Имитируя горный склон, необходимо наоборот разместить мелкие камешки внизу, а крупные — на вершине. Горная долина оформляется хаотичным расположением камней разных размеров.

Оформляя террасированный склон, из валунов делают ступеньки. Лесной овраг — это углубление, созданное из огромных камней. Каменистая стенка создается из плоских валунов, собранных в виде бордюра.

Итак, мы рассмотрели самые подходящие растения для альпийской горки, фото и названия которых вы нашли в статье. Все перечисленные представители флоры проверены годами в качестве жителей альпинария, поэтому можете смело выбирать из них на свой вкус. Не сомневайтесь, у вас получиться отличная горка из камней и растений, которая будет приковывать взгляд и дарить ощущение перемещения в пространстве. Подарите себе кусочек горного массива — соорудите альпийскую горку на приусадебном участке!

Смотрите видео: Какие растения подойдут для альпийской горки

стелющиеся многолетники, кустарники, карликовые, выбор для альпинария

Создание альпийской горки – увлекательный процесс, который требует не только фантазии, но и внимательности. Даже одно неправильно подобранное растение может испортить все впечатление, нарушив гармонию между другими обитателями каменистого сада. Поэтому нужно сделать правильный выбор из обширного списка растений, подходящих для составления композиции альпийской горки.

Содержание материала

Принципы посадки растений в альпинарии

Чтобы альпийская горка выглядела привлекательно в течение всего сезона, следует подбирать место для высадки растений, учитывая их сроки цветения и принцип ярусности:

  1. Верхушка горки. Она более открыта солнечным лучам, чем ярусы ниже; поэтому здесь рационально посадить растения, любящие солнечный свет и не нуждающиеся в большом количестве влаги.
  2. Средний ярус – место для растений, хорошо чувствующих себя в полутени. Здесь средняя влажность почвы, поэтому середину альпийской горки можно назвать универсальной: доя большинства цветов здесь идеальные условия, что дает широкие возможности для выбора.
  3. Подножие горки – логичное завершение ландшафтной композиции. Посаженные здесь растения должны сочетаться с остальными частями альпинария и выбрать те, которые любят влагу и переносят тень. Ведь большинство солнечных лучей будет доставаться соседям сверху.

Чтобы обеспечить непрерывное цветение с ранней весны до поздней осени, следует подбирать цветущие растения по принципу сменяемости. Вечнозеленые кустарники и карликовые деревца будут отлично смотреться и зимой, выглядывая из-под снега.

Создание альпийской горки – увлекательный процесс, который требует не только фантазии, но и внимательности

Схемы размещения растений в альпинарии

Прежде чем начать создание альпийской горки, нужно создать графическую схему. Она отразит общий замысел композиции, поможет появиться новым идеям и еще до высадки растений найти возможные ошибки.

В первую очередь обозначают камни. Самые большие должны быть в основании, а остальные должны создавать пологий склон так, чтобы на нем было место для почвы и корней растений. Можно поэкспериментировать, придумав террасы, резкие обрывы, водоем и другие интересные решения.

Вот пара примеров схем:

  1. Пряная горка, на которой расположены душистые цветы: верхушку займет душица, на среднем ярусе хорошо себя будет чувствовать вереск, иссоп, монарда и лекарственный шалфей, а у самого основания примостится базилик, яркая настурция и ароматный чабрец.
  2. Хвойная горка: туя, посаженая на верхушке, отлично смотрится в окружении стелющегося можжевельника среднего яруса (можно использовать разные виды) и плакучего кипарисника. Завершают альпинарий карликовые ели или сосны, почва под которыми замаскирована ковром камнеломки.

Каждый владелец участка имеет возможность создать уникальный дизайн ландшафтной горки. После составления схемы можно приступать к укладке камней и грунта, а затем к посадке растений.

Галерея: растения для альпийской горки (25 фото)

Какие растения подходят для альпийской горки (видео)

Названия и описания многолетних цветов для альпийской горки

Многолетники составляют основу альпийской горки. Поэтому к их выбору нужно подойти ответственно: от того, какие растения будут выбраны, зависит внешний вид композиции. Вносить новые краски и акценты можно ежегодно, подсаживая однолетние растения.

Армерия приморская

Компактное растение, кустики которого образуют пушистые зеленые подушки узких листьев. Над ними возвышаются многочисленные соцветия (около 10), представляющие собой сиреневые шары. Внешне армерия похожа на декоративный лук. Выносливое растение, плохо реагирующее на повышенную влажность грунта. Поэтому армерия будет хорошо себя чувствовать на верхушке горки или на склоне среднего яруса.

Дицентра исключительная

Этот растение в народе именуют «разбитым сердцем» за оригинальную форму цветков. Обычно дицентры представляют собой большой кустик, но Исключительная не превышает в высоту 25 см. Она хорошо сочетается с хвойными и ползучими растениями, поэтому станет отличной изюминкой альпинария. Зелено-сизая листва дицентры исключительной похожа на листья папоротника, а цветы в виде разъединенных половинок сердца могут быть белыми или розовыми.

Дицентра исключительная

Гипсофила

Растение принадлежит к семейству гвоздичных. Имеет прямостоячий или ползучий стебель с малым количеством маленьких листьев ланцетной формы, увенчанный соцветиями-метелками с мелкими белыми (редко-розовыми) цветочками.

Луковичные цветы

Это крокусы, нарциссы, подснежники и пролески. Они появляются сразу после схода нежного покрова, по-весеннему оживляя пейзаж. Для разнообразия можно посадить сортовые тюльпаны Грейга с цветками красивой формы, достигающие 30 см в высоту, и тюльпаны Кауфмана.

Гипсофила

Молодило

Каменная роза, как еще называют молодило, отличается превосходной выносливостью. При этом растение очень красиво: его мясистые угловатые листья собраны в розетки. Они могут быть как совсем миниатюрными, так и достигать 10 см в диаметре. Окраска листьев варьируется от серо-зеленой до бордовой. Каменная роза подходит для украшения склонов альпийской горки. Эффектно выглядит молодило, растущие в щелях между валунами.

Примула

Первоцвет (народное название примулы) – многолетнее травянистое растение. Его достоинства: ранее начало цветения, многообразие форм и окраски цветков, приятный запах. Примула низкоросла (высота 10–30 см), при одиночной посадке образует маленький кустик с кожистыми листьями и яркими соцветиями, привлекающими пчел. Если высадить первоцветы близко друг к другу, то получится пестрый ковер.

Эдельвейс

В народе растение еще называют горцем. Любит солнце, и в дикой природе растет на хорошо освещенных сторонах гор. Поэтому достойно займет центральное место на горке – ее верхушку. Летом эдельвейс удивит красивейшими звездчатыми цветами.

Как сделать альпийскую горку своими руками (видео)

Стелющиеся и почвопокровные растения для альпийской горки

Почвопокровные растения – неотъемлемый компонент альпийского пейзажа на участке. Они декорируют почву и делают склоны горки по-настоящему живыми.

Например, это:

  1. Антеннария (Кошачья лапка). Низкорослое растение, цветоносы которого не поднимаются выше 15 см. Имеет мелкие листья с серебристым оттенком и опушением создают плотный ковер на земле толщиной до 5 см. Соцветия-корзинки белого цвета, поэтому кошачью лапку нельзя назвать ярким растением, привлекающим взгляды. Зато оно очень выносливо!
  2. Барвинок. Образует вечнозеленый коврик, цветущий с мая до сентября нежными синими цветочками, разбросанными среди кожистых мелких листьев. Подходит для выращивания под солнечными лучами и на тенистом склоне: растение неприхотливость к свету.
  3. Двусемянник альпийский Низкое растение, формирующее декоративный дерновик, который не превышает высоты 3 см. В мае и июне на нем появляются соцветия до 15 см, представляющие собой кисти с многочисленными белыми цветками.
  4. Камнеломка. Одно из популярнейших почвопокровных растений. Время их цветения приходится на середину лета, причем окраска у разных видов различается: от белоснежной то темно-бордовой. Любит свет, поэтому нужно сажать на западном или южном склоне альпийской горки или ближе к ее верхушке.
  5. Обриета. Устилает землю пышным ковром. Обильно цветет на протяжении всей весны, и в этот период покрывается розовыми и фиолетовыми цветками. Любит солнце и суглинистые почвы, хотя хорошо растет и в любом грунте.
  6. Шиловидный флокс. Растение высотой 15–17 см, получившее название за узкие и заостренные на концах листья. Побеги плотно покрыты многочисленными соцветиями розового, белого или сиреневого цвета. Начало цветение приходится на май-июнь, и продолжается оно в начале сентября.

На одной горке уживаются несколько видов почвопокровных растений, если они гармонируют друг с другом. Учитывая их время цветения, можно сделать так, что почва будет покрыта ярким ковром с весны до осени.

Почвопокровные растения – неотъемлемый компонент альпийского пейзажа на участке

Кустарники для альпийских горок

В озеленении альпийских горок не рекомендовано использовать листопадные кустарники, потому что их листья, застревающие в щелях между камнями, трудно убирать, и композиция будет выглядеть неопрятной. Лучше остановить свой выбор на небольших вечнозеленых кустиках.

Например, кизильник горизонтальный, ветви которого растут параллельно грунту. Они украшены мелкими кожистыми листочками, которые с наступлением осени приобретают багряную окраску. После цветения появляются мелкие красные ягоды, остающиеся на ветвях всю зиму и придающие кизильнику особый шарм.

Интересным решением станет использование барбариса самшитолистного. Его куст вырастает не выше 50 см представляет раскидистую крону из многочисленных веточек. Очень неприхотливое растение, хорошо переносящее морозы и засуху. Любит свет, но и при выращивании в тени сохраняет свои декоративные свойства.

В озеленении альпийских горок лучше остановить свой выбор на небольших вечнозеленых кустиках

Карликовые растения для альпинария

Альпийская горка – это повторение горного ландшафта в миниатюре, поэтому для натуральности нужно использовать небольшие растения. Крупные кусты займут половину композиции и отвлекут внимание от других обитателей каменистого садика.

Можно использовать карликовые сорта травянистых растений (например, однолетних бархатцев или альпийскую астру). Желательно, чтобы их высота не превышала 30 см. И, конечно, завсегдатаями альпинариев являются карликовые хвойные: ель, сосна и др. Благодаря ним горка действительно похожа на уменьшенную копию альпийского рельефа.

Хвойники для альпийской горки

Для создания альпийского пейзажа используют низкорослые виды и сорта хвойных растений:

  1. Карликовые ели, высота которых не превышает 60 см. Они хорошо поддаются формировке и почти не требуют ухода. Форма кроны у разных сортов может быть раскидистой или пирамидальной.
  2. Можжевельник. Эффектно смотрятся виды, ветви которых растут параллельно земле. Хвоя растения часто имеет желтый оттенок, а ветки украшают маленькие шишечки. Можжевельник в дикой природе можно увидеть на склонах гор, поэтому нетребователен к почве и хорошо растет на камнях.
  3. Туя – кустарник или деревце пирамидальной формы, реже ее обрезают в виде шара.
  4. Горная сосна сорта «Мопс» растет очень медленно и к 10 годам своей жизни имеет крону диаметром до 50 см, что позволяет сажать деревце на альпийской горке. Зеленая хвоя имеет приятный голубой оттенок.
  5. Кипарисовик: его декоративные карликовые сорта эффектно украсит склон альпинария. Можно выбрать кустик с золотистой, серебристой или традиционной темно-зеленой хвоей. А кипарисовик Филифера обладает свисающими веточками, что выглядит как хвойный каскад.

Примеры и варианты альпийской горки (видео)

На горке необязательно сажать только те виды, которые растут в Альпах. Есть множество растений, используемых для создания альпинария на участке. Подобрав их правильно, можно создать уникальную композицию, которая будет радовать глаз весь год.

Speedwell - Как вырастить растения Veronica

Magic Show® «Wizard of Ahhs» вероника шипа.
Автор фотографии: Proven Winners

Для садоводов, у которых мало времени, выбор беззаботных растений является ключом к созданию двора, не требующего особого ухода. Вероника Вероника - крепкое декоративное растение, устойчивое к различным почвам и потребностям в поливе, причем сорта устойчивы в большинстве регионов. Размеры и формы варьируются от ползучих почвопокровников высотой в несколько дюймов до вертикальных цветочных шипов, достигающих нескольких футов в высоту.Низкорослые гроверы подходят для контейнеров, бордюров и альпинариев, в то время как более высокие вероники дают хорошие срезанные цветы и хорошо сочетаются с другими растениями на грядках и бордюрах. Почвопокровные растения обычно цветут весной, а колючие формы цветут летом.

Существует более 500 видов Veronica , происходящих из Европы. Почти все это долгоживущие многолетние растения, особенно те, которые выращивают домашние садоводы, хотя небольшой процент - однолетние. Цветы вероники привлекательны для колибри, бабочек и насекомых-опылителей, что делает их экологически чистыми.

На этой странице: Основы | Инструкции по посадке | Уход | Как правильно выбрать Веронику | Разновидности | Советы по ландшафтному дизайну

ОСНОВЫ SPEEDWELL

Зоны:

3-9

Высота / размах:

От 3 до 48 дюймов в высоту, от 8 до 24 дюймов в ширину

Выдержка:

Вероника лучше всего цветет при как минимум 6-часовом пребывании на открытом солнце, но может переносить полутень.

Время цветения:

С весны до осени, некоторые с повторным цветением.

Цвет и характеристики:

Цветы бывают синего, пурпурного, белого или розового цвета; с зеленой, золотой или серебряной листвой. Почвопокровные растения производят множество крошечных отдельных цветков или коротких цветочных шипов; и летнее цветение, более высокие сорта имеют грозди цветов, которые растут шипами.

Токсичность:

Вероника не считается токсичной для людей или домашних животных. Некоторые из них съедобны, а другие обладают растительными или лечебными свойствами.

ИНСТРУКЦИЯ ПО ПОСАДКЕ

Контейнер для патио "Pollinator Charmer" включает в себя: вертушку с шипами Magic Show® ‘Wizard of Ahhs’, шалфей Rockin® Deep Purple, кошачью мяту ‘Cat’s Pyjamas’, пчелиный бальзам ‘Pardon My Lavender’ и лантану Luscious® Citrus Blend ™.Автор фотографии: Proven Winners

Когда сажать:

Пересаживайте в более прохладные месяцы весной или осенью, чтобы избежать теплового стресса. Начинайте сеять в помещении в конце зимы или в начале весны, за 4-6 недель до вашего последнего среднего безморозного срока. Сейте семена прямо на улице в середине-конце весны, когда опасность заморозков миновала.

Место посадки:

Выберите солнечный участок с богатой, хорошо дренированной почвой. Вероника может переносить целый ряд почвенных условий и после укоренения становится засухоустойчивой.Посадка в слишком большой тени может привести к меньшему количеству цветов.

Как сажать:

Разрыхлите почву на глубину контейнера и в два раза больше диаметра и смешайте с компостом. Выньте растение из контейнера и аккуратно вырвите корни, если они забиты. Выкопайте яму и поместите растение так, чтобы верхушка корневого кома была на одном уровне с поверхностью почвы. Аккуратно утрамбуйте почву вокруг основания и хорошо полейте. Расстояние будет варьироваться от 10 до 20 дюймов в зависимости от разновидности. При выращивании из семян осторожно вдавливайте семена в почву, но не накрывайте их, так как свет способствует прорастанию.Держите во влажном состоянии, пока семена не прорастут примерно через 14-21 день.

СОВЕТЫ ПО УХОДУ

Обрезка и уход:

Для вертикальных растений обрежьте опавшие цветы чуть ниже колоса, чтобы стимулировать повторное цветение. Более высокие сорта могут нуждаться в ставке. Все виды можно разделить весной или осенью каждые несколько лет по мере необходимости, особенно если отмирание происходит в центре растения.

Почва:

Большинство вероников лучше всего растут в исправленной, хорошо дренированной почве. Они толерантны к глине или песку, а также к нейтральному, щелочному или кислому pH.

Дополнения и удобрения:

Весной покройте почву вокруг растения тонким слоем компоста, затем добавьте два дюйма мульчи, чтобы подавить сорняки и сохранить влажность. Не покрывайте крону растения компостом или мульчей.

Полив:

Поливайте один раз в неделю летом или чаще в жаркие периоды.

Болезни и вредители:

При посадке на идеальном участке вероника устойчива к большинству вредителей и болезней.Если посадить веронику в слишком тенистом месте, могут развиться грибковые заболевания, такие как мучнистая роса, ржавчина и пятнистость листьев. Плохой дренаж может вызвать загнивание корней. Проблемы с насекомыми включают чешуйку, паутинный клещ и трипсы.

Устойчивость к оленям:

Вероника имеет тенденцию к устойчивости к оленям, хотя в экстремальных условиях олени могут пастись на растениях, которых в противном случае не было бы.

КАК ВЫБРАТЬ ПРАВИЛЬНУЮ ВЕРОНИКУ

При таком большом количестве разновидностей, вот несколько советов, которые следует учитывать:

Для уклонов, стен и подстилки:

Используйте сорта с сильным распространением, чтобы покрыть большие площади.

Для обрамления дорожек и альпинариев:

Сажайте почвопокровные растения вдоль дорожек, между брусчаткой, по краям бордюров или в альпинариях в сочетании с другими альпийскими растениями.

Для контейнеров, подвесных корзин и оконных ящиков:

Используйте почвопокровные сорта, которые будут тянуться за край, и сажайте в сочетании с другими растениями с бугристыми и прямостоячими формами. Более мелкие колючие виды также можно комбинировать в контейнерах с другими растениями с аналогичными потребностями в выращивании.

Для смешанных бордюров:

Прямостоячие сорта комбинируются с другими летнецветущими многолетниками и кустарниками.

РАЗНООБРАЗНЫЕ СОРТА

Проведите по экрану для просмотра слайдов

Автор фото: Proven Winners.

Magic Show® ‘Wizard of Ahhs’ - Купить сейчас у проверенных победителей
Вероника Спайк, Вероника гибрид

Зоны: 4-8
Высота / ширина: Распространение на холмах, от 14 до 16 дюймов в высоту и от 18 до 22 дюймов в ширину
Воздействие: От полного солнца до полутени
Время цветения: От раннего до конца лета

Исключительно долгое время цветения добавляет красок дисплеям для клумб, вдоль дорожек и границ или в контейнерах с другими растениями.

Автор фото: Proven Winners.

Magic Show® ‘Pink Potion’ - Купить сейчас у проверенных победителей
Спайк вероника, Вероника гибрид

Зоны: 4-8
Высота / ширина: Форма распространения холмов, высота от 14 до 16 дюймов и ширина от 18 до 22 дюймов
Воздействие: Частичное или полное солнце
Время цветения: Ранняя середина лета

Цветы лучше всего на солнце, срезанные после цветения. Идеально подходит для контейнеров или от края до середины бордюров.

Автор фото: Proven Winners.

Magic Show® ‘White Wands’ - Купить сейчас у проверенных победителей
Вероника Спайк, Вероника гибрид

Зоны: 4-8
Высота / распространение: Распространение на холмах, высота от 14 до 16 дюймов и ширина от 16 до 20 дюймов
Воздействие: От полного солнца до полутени
Время цветения: Ранняя середина лета

Чистый белый цвет цветов охлаждает сад в жаркие летние месяцы и хорошо сочетается со многими другими растениями.

Автор фотографии: agatchen / Shutterstock

Royal Candles (син. «Glory»)
Вероника Спайк, Veronica spicata

Зоны: 3-8
Высота / ширина: Прямоугольный габитус, высота от 8 до 12 дюймов и ширина от 12 до 18 дюймов
Воздействие: Полное солнце
Время цветения: Раннее и позднее лето

Его исключительно долгое время цветения и меньший рост делают его идеальным для небольших пространств, вдоль границ, в контейнерах или в большом количестве на подстилке.

Автор фотографии: photowind / Shutterstock

«Первая любовь»
Спидвелл, Вероника гибрид

Зоны: 4-8
Высота / разброс: Тип распределения вертикального, 16 дюймов в высоту и от 12 до 18 дюймов в ширину
Воздействие: Полное солнце
Время цветения: Раннее-позднее лето

Это исключительно длинное цветущее растение имеет равномерное разветвление, которое приводит к разрастанию цветочных колосьев. Используйте на краю бордюров или дорожек, в альпинарии или в контейнере с другими растениями.

Фото: Крис Форбс / Alamy Stock Photo

«Сосулька»
Вероника Спайк, Вероника Спиката

Зоны: 3-8
Высота / ширина: Прямоугольный габитус, высота от 20 до 24 дюймов и ширина от 12 до 24 дюймов
Воздействие: Полное солнце
Время цветения: Раннее и позднее лето

Высокий рост делает акцент на крупномасштабном ландшафте, когда он сосредоточен в смешанном или коттеджном стиле.Контрастируйте с более горячими оттенками или комбинируйте с более холодными оттенками лаванды, розового и синего. Хорошие срезанные цветы.

Автор фотографии: Джанет Лоури

"Georgia Blue"
Вероника ползучая, Veronica peduncularis (син. V. umbrosa )

Зоны: 6-8
Высота / ширина: Ползучий тип распространения, от 6 до 8 дюймов в высоту и от 12 до 18 дюймов в ширину
Воздействие: Полное солнце
Время цветения: Ранняя середина весны, возможно редкое повторное цветение в конце лета
Цвет: Сапфирово-синие цветы с белым центром, средне-зеленая листва

Устойчивый к различным условиям, это невысокое матовое почвопокровное растение с цветками в форме блюдца и зелеными листьями с бронзовым оттенком, легко разрастается.

СОВЕТЫ ПО ЛАНДШАФТУ

Есть много способов добавить этот надежный многолетник в любой ландшафт. Вот как:

  • Используйте почвопокровные или карликовые растения в альпинарии в сочетании с альпийскими растениями, такими как коломбина, очиток, диантус, тимьян и стелющийся флокс.
  • Чередование почвопокровных и карликовых сортов с разным временем цветения по краю бордюра или дорожки в течение месяцев длительного окрашивания.
  • Чтобы создать живую тропу, разместите ступеньки на расстоянии 6–9 дюймов друг от друга и засаживайте промежутки между ними почвопокровной вероникой и другими низкорослыми растениями, такими как ползучий тимьян, аджуга, ползучая Дженни и корсиканская мята.
  • Используйте висячие сорта в контейнере, оконном ящике или подвесной корзине в сочетании с другими растениями с цветной листвой или цветущими летом цветами для получения цвета в течение всего сезона.
  • Белые формы являются элегантным дополнением к белоснежному саду, создавая волшебный световой эффект теплыми летними вечерами.
  • Вероника хорошо сочетается со многими другими многолетниками. Возможные компаньоны: тик, лилейник, тысячелистник, дамская накидка, шалфей, колокольчик, ромашка шаста и коралловые колокольчики.Для раннецветущих типов комбинируйте с луковицами весеннего цветения, такими как тюльпаны и нарциссы.

СВЯЗАННЫЙ:
24 фиолетовых цветка, чтобы украсить ваш сад
21 синий цветок для вашего сада
Идеи для очаровательного коттеджного сада
Цветовые схемы сада

Что такое альпийская горка - Идеи и советы для сада на альпийских холмах

Попытаться имитировать естественную красоту альпийских гор в саду - непростая задача. Прежде всего, вам нужен правильный сайт, а затем вам нужно установить много камней.Выбор растений, которые будут процветать в этой суматохе флоры, является последней ключевой деталью альпийского сада с горками. Но с небольшим предварительным планированием даже начинающий садовник может создать восхитительный дизайн альпийской горки, который будет радовать глаз и прост в уходе.

Что такое альпийская горка?

Что такое альпийская горка? Представьте себе сад камней, но с искусно подобранными растениями, которые будут прыгать внутри и вокруг камня разных размеров. После созревания должен получиться эффект бесшовного союза между живым и неорганическим.Узнайте несколько советов о том, как сделать альпийскую горку и превратить эту уникальную особенность в свой ландшафт.

Представьте себя в горном походе в Альпах весной. Вы найдете множество прорастающих местных растений и цветущих образцов во всей их красе. Это очень суровый, но волшебный пейзаж. Теперь перенесите концепцию в домашний сад.

Идеальный альпийский сад с горками будет сочетать в себе элементы диких холмов и растений, выглядывающих среди скал. Это смелый и амбициозный дизайн, который придаст пейзажу интересное измерение и станет центром внимания.Не существует правильного или неправильного способа сделать альпийский холм, но вам нужно иметь или найти каменистые ингредиенты, чтобы начать проект.

Как сделать альпийскую горку

Если у вас уже есть каменистый участок, значит, вы на пути к созданию альпийской горки. Даже если камней не хватает, можно создать дизайн альпийской горки. Либо приобретите камень, либо используйте предметы, которые у вас есть.

Одна из идей - построить насыпь из кусков бетона. Идея состоит в том, чтобы иметь наклонный участок с материалом разного размера, залитый песчаным грунтом.Вы можете сделать его высоким или относительно низким. Просто помните, что когда придет время выбирать растения, насыпь с большим уклоном быстро высохнет, и верхние растения будут получать много солнечного света, если горка не будет построена в частично затененном месте.

Растения для создания альпийской горки

Следите за расположением солнца днем ​​на своем альпийском участке. Выбор растений, которые будут хорошо расти при таком освещении, имеет решающее значение для их здоровья. Кроме того, из-за уклона вода будет стекать.Это оставляет верхнюю зону более сухой, чем нижнюю.

Выберите растения для каждого региона, которые будут соответствовать количеству воды, которое они получат. Некоторые предложения могут быть такими:

пустынных растений | Парки штата Аризона

Перейти к: Цветущие растения | Кактус | Деревья

Разнообразие пустынных растений Аризоны поразительно и красиво. Местная флора всех пустынь Аризоны создана для процветания в засушливой и беспощадной среде. Этот дизайн включает шипы, шипы и совершенно великолепные цвета.Бобы, фрукты, стручки и, конечно же, множество цветов украшают этот буквальный шведский стол, чтобы гарантировать, что дикая природа пустыни будет хорошо накормлена среди моря визуально стимулирующей пустынной растительности. Для организации мы разделим эти пустынные растения на три категории; Цветущие растения, кактусы и деревья. Ознакомьтесь со списком пустынных растений ниже, а затем спланируйте поездку в парк штата Аризона, чтобы насладиться его разнообразием!

Цветущие растения

Цветущие растения Аризоны цветут в разное время года, хотя весна сезон полевых цветов , как правило, является лучшим временем для просмотра незабываемых ярких цветных полей.При обильных дождях в конце зимы / начале весны пустыни Аризоны оживают с конца февраля по апрель и привлекают посетителей со всего мира, чтобы полюбоваться великолепием. Многие из этих цветущих пустынных растений также привлекают колибри, чтобы по-настоящему подчеркнуть красочный весенний парк!

Астра болотная Астра бледная

Астра болотная встречается в прибрежных и водосборных зонах по всей Аризоне.Как следует из названия, этот заповедник находится в непосредственной близости от обычного источника воды.

Хрупкий куст Encelia farinosa

Многие каменистые пустынные склоны и склоны холмов Аризоны весной зацветают желтыми цветами хрупкого кустарника. Это очень распространенный, но чрезвычайно красивый вид полевых цветов.

Bluedicks Dichelostemma capitatum

Этот член семейства лилий имеет большой ареал, охватывающий самые низкие пустыни до семи тысяч футов! Bluedicks на самом деле может не быть синим, в зависимости от того, где вы находитесь...Белые, пурпурные и розовые цветы можно увидеть во всем их диапазоне.

Чупароза Белоперон калифорнийский

Полусуккулентные трубчатые цветки чупарозы обычно красного цвета, хотя оранжевые и желтые варианты можно найти по всему ареалу пустыни Сонора. Цветы чупарозы - фаворит зимующих в пустыне колибри.

Люпин Коултера Люпин спарсифлорус

Обычно встречаются на глубине 4500 футов в центральной и южной Аризоне. (Обычно) голубовато-пурпурные цветы этого красивого однолетнего растения могут варьироваться от розового до белого в разной степени. Сезон цветения с марта по май.

Пустынный Чиа Salvia columbariae

Из 16 видов Salvia , найденных в Аризоне, разновидность Desert является наиболее распространенной.Синие (или фиолетовые) цветы обычно цветут с марта по май на высоте в пустыне ниже 3500 футов.

Цикорий пустынный
Rafinesquia neomexicana

Этот небольшой представитель семейства подсолнечников с белыми цветами, обычно ниже двух футов в высоту, встречается в гравийных или песчаных районах пустынь Мохаве и Сонора на высоте от 200 до 3000 футов над уровнем моря.

Бархатцы пустынные Baileya multiradiata

Яркий пустынный многолетник с короткой продолжительностью жизни, цветет в марте и с перерывами в течение ноября. Встречается на каменистых склонах и песчаных участках дна пустыни на высоте от 100 до 6000 футов.

Примула пустынная Oenothera primiveris

Найденные на дне пустыни на высоте до 4500 футов, эти однолетние травы обычно цветут на песчаном дне пустыни и связанном с ними рельефе, таком как холмы и водоемы.

Дезертстар Дейзи Моноптилон беллидиформенный

Это однолетнее растение обычно встречается в пустынях и других песчаных местах на высоте ниже 3000 футов над уровнем моря. Это наземное пустынное растение растет гроздьями, украшенными небольшими белыми цветами.

Мак калифорнийский Eschscholzia californica

Калифорнийский мак произрастает по всей пустыне Сонора, и его очень много в годы, когда выпадает больше среднего количества осадков.

Gravel Ghost Atrichoseris platyphylla

Эти белые цветы, обычно встречающиеся в промоинах пустынь и долинах ниже 4500 футов, кажутся «призрачно» парящими на своих высоких (до 2,5 футов) тонких стеблях.

Fairy duster Calliandra eriophylla

Тонкие, шипучие цветы варьируются от светло-розового до оранжевого по всему пустынному региону.Fairy Duster, важный продукт питания для множества обитающих в пустыне птиц и животных, находится ниже 5000 футов на открытых склонах холмов и песчаных промывках.

Fiddleneck Amsinckia intermedia

В годы, когда количество осадков выше среднего, желто-оранжевые соцветия будут особенно обильны и найдены на густых участках в горной пустыне.Это растение при контакте вызывает раздражение кожи человека.

Драгоценный цветок лирелы Streptanthus arixonicus

Это небольшое двулетнее или однолетнее цветущее растение на самом деле принадлежит к семейству горчичных. Интересно, что белые цветы по мере распространения на восток становятся желтыми. В Аризоне большинство ювелирных цветов белые.

Чертополох Нью-Мексико Cirsium neomexicanum

Этот запрет может достигать более шести футов в высоту во всем своем ареале. Цветет чертополох с марта по сентябрь после осадков выше среднего.

Пурпурный мат Nana demissum

Небольшой весенний однолетник, растущий большими «циновками» с многочисленными пурпурными цветами.Присутствует только после зимних осадков выше среднего в пустынных равнинах и на каменистых участках возле смывов.

Клевер пурпурной совы Castilleja exserta

После периодов осадков, превышающих средний уровень, эти прекрасные однолетние травянистые растения могут давать огромные полосы цвета на открытых пустынных территориях с марта по май.

Рок Дейзи Perityle emoryi

Небольшая, нежная, ежегодно повторяющаяся трава, Каменная маргаритка обычно встречается в относительно открытых каменистых или песчаных пустынных районах.

Скорпион сорняк Phacelia distans

Сорняк-скорпион обычно цветет с февраля по июнь и обычно встречается вдоль промоин пустынь и склонов холмов на высоте от 1000 до 4000 футов.

Желтые чашки
Camissonia brevipes

Эти маленькие желтые цветы лучше всего цветут в годы, когда в пустыне выпадает много осадков, и обычно они растут в западной Аризоне на высоте от 300 до 6000 футов над уровнем моря.

Кактус

Разнообразные сообщества пустынных растений Аризоны не были бы полноценными без кактусов! Различные виды кактусов Аризоны вызывают в воображении образы западной культуры и даже стали синонимами культуры штата Гранд-Каньон.Упомяните Аризону всем, кто здесь не живет, и они, скорее всего, подумают о высоком и могучем сагуаро или груши с фруктами! Проведите здесь достаточно времени, и у вас будут незабываемые встречи с кактусами. Незабываемое море красных цветов на окотилло приятно, как и аромат дыни цветка сагуаро ... Но опять же, воспоминания о стране кактусов обычно связаны с парой пинцета.

Бочка Кактус Ferocactus wislizeni

Стволовый кактус - очень выносливое растение, его можно найти на дне пустыни на высоте до 5000 футов.Цветы появляются в конце лета и могут быть желтыми, оранжевыми или красными в зависимости от местоположения.

Олень обыкновенный cylindropuntia acanthocarpa

В пустынях Мохаве и Сонора в Аризоне произрастают шесть разновидностей чоллы из облепихи. Цветение происходит с апреля по май, и цвет цветка и колючки могут отличаться у отдельных экземпляров в пределах ареала.

Цепной плод cholla, Cholla прыгучая Cylindropuntia fulgida

Цепной фруктовый чолла произрастает на высоте от 500 до 2500 футов в пустыне Сонора в Аризоне. Плоды являются важным продуктом питания для дикой природы пустыни и могут расти непрерывно в течение всего года. Пурпурные цветы цветут с апреля по сентябрь, хотя пик цветения - июнь.

Еж Echinocereus triglochidiatus var. аризоникус

Найден на большей части территории пустыни Сонора в центральной и южной части Аризоны на высоте от 3000 до 5300 футов над уровнем моря. Блестящие красные или розовые цветки появляются в апреле или мае.

Опунция опунция разные

Название «Колючая груша» представляет собой более 12 разновидностей мягких кактусов, встречающихся на юго-западе Америки.Несколько видов встречаются по всей Аризоне от уровня моря до 8000 футов. Плоды являются важным продуктом питания диких животных и обычно созревают летом.

Ocotillo Fouquieria splendens

Окотилло широко распространен в пустынях Сонора и Чиуауа и предпочитает расти там, где почва хорошо дренирована, например, на каменистых склонах и вдоль высокогорных промоин пустынь.Весной или ранней осенью распускаются ярко-красные / оранжевые цветы.

Сагуаро Carnegiea gigantea

Сагуаро - символ пустыни Сонора, а также самый легко узнаваемый вид кактусов Аризоны, не очень морозостойкий и предпочитает жить на глубине ниже 3500 футов. Цветок штата Аризона цветет с Сагуаро с конца апреля по июнь и раскрывается только ночью, опыляется преимущественно летучими мышами.

Плюшевый мишка чолла Cylindropuntia bigelovii

Этот вид супер-колючей чоллы обитает на глубине более 3000 футов в пустынях Мохаве и Сонора на теплых открытых склонах холмов, на каменистых промоинах и песчаных равнинах. Плюшевый мишка Чолла может цвести дважды в год, один раз с марта по июнь и еще раз в сентябре.

Деревья

Деревья пустыни, произрастающие в пустыне Сонора в Аризоне, очень полезны для дикой природы и других растений в их сообществах.Тень, создаваемая деревьями пустыни, дает животным столь необходимый отдых от летнего солнца и дает другим растениям, которым не нужен полный солнечный свет, шанс на процветание. Деревья служат домом для птиц и выращивают пищу в виде бобов и цветов, которые пустынные птицы и животные используют, чтобы помочь им выжить в суровых условиях пустыни.

Кошачий коготь Акация Senegalia greggii

Обычно встречающаяся в местах обитания мелколепестника, на равнинах и вдоль промоин ниже 4500 футов, акация кошачьего когтя является основным продуктом пустыни, который цветет ежегодно с апреля по октябрь.Путешественники опасаются коротких шипов типа «кошачий коготь», которые могут разорвать одежду и кожу!

Айронвуд Olneya tesota

Айронвуд - относительно большое пустынное дерево, которое может вырасти до 30 футов или более около предгорий пустыни или сообществ мытья пустыни ниже 2500 футов над уровнем моря. Бледно-фиолетовые или белые цветки распускаются с мая по июнь.

Мескит Prosopis juliflora var. Торрейана

Еще одно большое пустынное дерево, мескитовое дерево, предпочитает дренажные коридоры пустынь Сонора и Мохаве. Мескиты производят бобы, которые используются дикой природой пустыни, и желтые цветы с марта по август.

Предгорье Пало-Верде Parkinsonia microphylla

Предгорный пало-верде дико растет по всей пустыне Сонора ниже 4000 футов и обычно предпочитает склоны холмов и другие горные районы сообществам, омываемым пустынями.Ярко-желтые цветки распускаются с апреля по май.

Смородина альпийская | Дендрарий Мортона

Смородина альпийская (Ribes alpinum ) - выносливый низкорослый кустарник, обычно используемый в качестве живой изгороди. Растения толерантны к полному солнцу и полной тени. Очень низкие эксплуатационные расходы с небольшой декоративной привлекательностью, кроме густой зеленой листвы.

Размер и форма:

Округлый ветвистый листопадный куст, достигающий 3–6 футов в высоту и 6–7 футов в ширину, альпийская смородина часто используется в качестве неформальной живой изгороди.

Родное географическое положение и среда обитания:

Этот кустарник произрастает в Европе и России.

Привлекает птиц, опылителей или диких животных:

Это привлекает птиц и бабочек.

Цвет и текстура коры:

От светло-серо-коричневого до коричневого, более старые стебли отслаиваются.

Расположение, размер, форма и текстура листьев или игл:

Листья очередные, яйцевидные, с 3-5 лопастями и от 1 до 2 дюймов в длину

Цветочная композиция, форма и размер:

Двудомный кустарник с отдельными мужскими и женскими растениями.Цветки Незначительные, зеленовато-желтого цвета.

Описание плодов, шишек, орехов и семян:

Плоды развиваются только на женских растениях. Они алые, сочные ягоды.

Уход за растениями:

Размещайте альпийскую смородину на открытом солнце в полной тени на влажных, хорошо дренированных почвах, но адаптированных к pH почвы, глинистых, уплотненных, сухих почвах. Смородина альпийская хорошо поддается обрезке и ее можно стричь. Он очень зимостойкий, устойчив к глинам, засухе, сухой почве, ветру, щелочной почве и кроликам

Болезни, вредители и проблемы:

Смородина альпийская восприимчива к пятнистости листьев, тле, чешуе, ржавчине и антракнозу.

Зеленая смородина альпийская (Ribes alpinum ‘Green Mound’):

Это мужская форма, от 2 до 3 футов в высоту и ширину.

Смородина карликовая альпийская (Ribes alpinum ‘Pumilum’):

Подобно Green Mound, этот сорт самец и от 2 до 3 футов в высоту.

Смородина альпийская Green Jeans ™ (Ribes alpinum ‘Spreg’):

Женский сорт, этот куст вырастает от 3 до 5 футов в высоту и имеет широкую блестящую темно-зеленую листву.

PERPETUAL FLOWERING2 координирует реакцию яровизации и многолетнее цветение Arabis alpina | Журнал экспериментальной ботаники

Абстрактные

Цветочный репрессор APETALA2 (AP2) у Arabidopsis регулирует цветение через возрастной путь. Ранее сообщалось, что ортолог AP2 альпийского многолетника Arabis alpina , PERPETUAL FLOWERING 2 ( PEP2 ) контролирует цветение путем усиления экспрессии другого репрессора цветков ( PERPETUAL PERPETUAL). PEP1 ), ортолог Arabidopsis FLOWERING LOCUS C ( FLC ).Однако PEP2 также регулирует цветение независимо от PEP1. Чтобы охарактеризовать функцию PEP2 , мы проанализировали транскриптомы мутантов pep2 и pep1 . Большинство дифференциально экспрессируемых генов было обнаружено между pep2 и диким типом или между pep2 и pep1 , что подчеркивает важность роли PEP2 , которая не зависит от PEP1 . Здесь мы демонстрируем, что активность PEP2 предотвращает повышающую регуляцию A.alpina гены идентичности цветочной меристемы FRUITFUL ( AaFUL ), LEAFY ( AaLFY ) и APETALA1 ( AaAP1 ), обеспечивающие приверженность цветков во время яровизации. Молодые pep2 проростков реагируют на яровизацию, подтверждая, что PEP2 регулирует возрастную реакцию на яровизацию независимо от PEP1. Основная роль PEP2 через PEP1 -зависимый путь происходит после яровизации, когда он способствует активации PEP1 как в верхушке главного побега, так и в подмышечных ветвях.Эти множественные роли PEP2 в реакции яровизации вносят вклад в жизненный цикл A. alpina .

Введение

Адаптация растения к окружающей среде требует изменения признаков развития, среди которых время цветения является ключевым для обеспечения успешного производства потомства. В альпийских местообитаниях, в которых выживаемость молоди очень низкая, в основном преобладают многолетние виды (Billings and Mooney, 1968). В целом, привычка к многолетнему росту зависит от различного поведения меристем на одном и том же растении, так что одни останутся вегетативными, а другие начнут цветение (Amasino, 2009; Lazaro et al., 2018). Основным признаком окружающей среды, который способствует цветению у альпийских видов, является длительное воздействие холода - процесс, называемый яровизацией. Альпийская среда характеризуется коротким вегетационным периодом и длительными периодами снежного покрова. Таким образом, для обеспечения репродуктивного успеха альпийские растения закладывают цветочные почки в ответ на продолжительный холод за несколько месяцев или лет до цветения (Diggle, 1997; Meloche and Diggle, 2001). Однако длительные холода не всегда приводят к цветению.Это особенно верно для многолетних видов, так как большинство из них имеют длительную ювенильную фазу и не способны к цветению в молодом возрасте (Bergonzi and Albani, 2011).

Молекулярные механизмы, регулирующие цветение в ответ на яровизацию или возраст растения, в основном изучались на модельном однолетнем растении Arabidopsis thaliana . Фактор транскрипции MADS box FLOWERING LOCUS C (FLC) является основным регулятором цветения в ответ на яровизацию (Michaels and Amasino, 1999; Sheldon et al., 2000). FLC транскрипционно регулирует гены цветочных интеграторов, такие как SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 ( SOC1 ), и гены, участвующие в возрастном пути, что предполагает взаимодействие между этими двумя путями (Deng et al. , 2011; Mateos et al. др. , 2017). Сравнительные исследования арабидопсиса и альпийского многолетника Arabis alpina показали, что ортолог FLC у A. alpina , PERPETUAL FLOWERING1 ( PEP1 ) также контролирует цветение в ответ на яровизацию.Кроме того, PEP1 способствует многолетнему росту, подавляя цветение в подмножестве пазушных меристем после яровизации (Wang et al. , 2009; Lazaro et al. , 2018). Цветочные почки у A. alpina образуются при длительном воздействии яровизационных условий. Продолжительность яровизации определяет реактивацию ПЭП1 и в соцветии. После недостаточной яровизации мРНК PEP1 реактивируется, что приводит к появлению фенотипов реверсии цветков, таких как прицветники и ветви вегетативного соцветия (Lazaro et al., 2018). В подмышечных ветвях продолжительность яровизации не влияет на экспрессию PEP1 , а транскрипт PEP1 является высоким независимо от продолжительности яровизации (Lazaro et al. , 2018). Судьба этих подмышечных ветвей определяется комбинированным действием возрастного пути и PEP1 (Wang et al. , 2011; Park et al. , 2017).

У Arabidopsis путь возраста регулируется двумя miRNA и их мишенями.В молодом возрасте высокие уровни miRNA 156 (miR156) препятствуют цветению. По мере того как растения стареют, накопление miR156 постепенно снижается, тогда как уровни miR172 следуют противоположному паттерну и постепенно увеличиваются во время развития (Wu et al. , 2009). Биологическая функция miR156 осуществляется его мишенями, которые кодируют членов семейства транскрипционных факторов SQUAMOSA PROMOTER BINDING PROTEIN-LIKEs (SPL) (Schwab et al. , 2005; Wu and Poethig, 2006; Wu et al. , 2009; Сюй и др., 2016). Исходя из этого, SPL9 и SPL15, как сообщается, активируют транскрипцию miRNA172b , которая, в свою очередь, подавляет экспрессию небольшого подсемейства APETALA2-подобных факторов транскрипции с помощью механизма трансляции (Aukerman and Sakai, 2003; Chen, 2004; Mathieu и др. , 2009 г .; Wu и др. , 2009 г .; Hyun и др. , 2016 г.). Это подсемейство включает шесть членов: AP2, ЦЕЛЬ РАННЕЙ АКТИВАЦИИ, TAGGED1–3 (TOE1 – TOE3), SCHLAFMUTZE (SMZ) и SCHNARCHZAPFEN (SNZ) (Aukerman and Sakai, 2003; Schmid et al., 2003 г .; Mathieu et al. , 2009 г .; Янт и др. , 2010). Arabis alpina имеет ярко выраженную ювенильную фазу, и образец Pajares должен расти не менее 5 недель в течение длинных дней (LD), прежде чем он сможет зацвести в ответ на яровизацию (Wang et al. , 2011; Bergonzi ). и др. , 2013). Роль miR156 сохраняется в A. alpina , поскольку линии с повышенной экспрессией miR156b блокируют цветение в ответ на яровизацию, тогда как линии мимикрии (MIM156), используемые для снижения активности miRNA, цветут при яровизации в возрасте 3 недель (Bergonzi et al., 2013). Однако дополнительное временное накопление miR156 и miR172 во время развития не связано у A. alpina (Bergonzi et al. , 2013). Подобно A. thaliana , накопление miR156 снижено в верхушке побега растений A. alpina , которые стареют и приобретают способность цвести в течение долгих дней, но экспрессия miR172 низкая (Bergonzi et al. , 2013). Чтобы наступило цветение и наблюдали повышение уровня miR172 на верхушке побега, необходима яровизация (Bergonzi et al., 2013). Однако яровизация эффективна только для зрелых (старых) растений, но не для ювенильных (молодых) растений, которые все еще имеют высокие уровни miR156 (Bergonzi et al. , 2013). Начало цветения во время холода у зрелых растений коррелирует с постепенным увеличением экспрессии генов идентификации органов цветка LEAFY ( AaLFY ), FRUITFUL ( AaFUL ) и APETALA1 ( AaAP1). Лазаро и др. , 2018).У многолетних растений, таких как яблоня и тополь, гомологи репрессора цветов TERMINAL FLOWER1 ( TFL1 ) регулируют ювенильный период. Трансгенные линии Malus domestica и Populus trichocarpa со сниженной экспрессией TFL1 имеют укороченную ювенильную фазу (Kotoda et al. , 2006; Mohamed et al. , 2010). Точно так же трансгенные растения A. alpina , в которых экспрессия AaTFL1 была снижена, могут цвести, даже если они яровизированы в молодом возрасте (Wang et al., 2011). Интересно, что эти линии могут зацвести после короткого (6 недель вместо 12 недель) периода яровизации. Эти результаты снова предполагают взаимодействие между возрастом и путями яровизации.

У Arabidopsis AP2 влияет на различные процессы развития, включая время цветения в зависимости от возраста и развитие цветков (Yant et al. , 2010). Сильные рецессивные мутантные аллели ap2 , такие как ap2-12 , цветут рано как в LD, так и в короткие дни (SD) (Yant et al., 2010). Аналогичным образом, поражения в ортологе A. alpina из AP2 , PEP2 , как сообщается, имеют фенотип времени цветения (Bergonzi et al. , 2013). pep2 мутанты цветут без яровизации и демонстрируют скомпрометированные многолетние признаки, подобные мутантным растениям pep1-1 (Bergonzi et al. , 2013). Эффект PEP2 на цветение сначала был связан с путем яровизации, поскольку он способствует экспрессии PEP1 (Bergonzi et al., 2013). В 2-недельных проростках pep2-1 уровни транскрипта PEP1 снижены по сравнению с растениями дикого типа (Bergonzi et al. , 2013). Однако PEP2 также играет независимую от PEP1 роль в регуляции времени цветения у A. alpina , поскольку цветение ускоряется у двойного мутанта pep1-1 pep2-1 по сравнению с одиночными мутантами (Bergonzi и др. , 2013).

Здесь мы показываем, что во время яровизации PEP2 репрессирует экспрессию генов идентичности меристемы цветков AaFUL , AaLFY и AaAP1 .Яровизация ускоряет цветение у молодых pep2-1 растений, что указывает на то, что PEP2 регулирует возрастную реакцию на яровизацию. Кроме того, мы сообщаем, что PEP1 -зависимая роль PEP2 имеет место после яровизации, потому что PEP2 требуется для активации PEP1 после возврата к теплым температурам. Участие PEP2 в двух различных аспектах реакции яровизации способствует многолетнему жизненному циклу A.Альпина .

Материалы и методы

Растительный материал, условия роста и фенотипирование

Генотипы A. alpina , использованные в этом исследовании, представляли собой Pajares (дикий тип), мутант pep2-1 и мутант pep1-1 . Образец Pajares был собран в горах Кордильера Кантабрика в Испании на высоте 1400 м (42 ° 59'32''N, 5 ° 45'32''W). Как мутант pep2-1 , так и мутант pep1-1 были выделены в результате мутагенеза EMS (этилметансульфонат) на фоне Pajares (Wang et al., 2009 г .; Бергонци и др. ., 2013; Nordstrom et al ., 2013). Для фенотипического анализа растения выращивали в ЛД (16 часов света и 8 часов темноты) при температуре от 20 ° C днем ​​до 18 ° C ночью. Все яровизированные обработки проводили при 4 ° C в условиях SD (8 часов света и 16 часов темноты).

Время цветения молодых растений дикого типа, pep2-1 и pep1-1 оценивали как количество листьев при цветении и как количество дней до первого распустившегося цветка после яровизации.Растения выращивали в течение 3 недель в шкафах LD, яровизировали в течение 12 недель и возвращали в камеры LD после холода.

Характеристика времени цветения и признаков соцветия с различной продолжительностью яровизации у мутанта pep2-1 была проведена вместе с диким типом и мутантом pep1-1 в ранее опубликованном эксперименте (рис. 6 в Lazaro et al. al., 2018). Те же данные для контрольных растений дикого типа были использованы в Lazaro et al. (2018).Растения выращивали в течение 5 недель в теплице LD, яровизировали в течение 8, 12, 18 и 21 недель и возвращали в условия теплицы LD в тот же день. Время цветения измеряли, записывая дату раскрытия первого цветка после яровизации. Количество цветущих и вегетативных ветвей, а также количество прицветников в соцветии измеряли в конце цветения, за исключением растений, яровизированных в течение 8 недель, когда измерения проводились через 14 недель после яровизации.

Используемые здесь генотипы Arabidopsis были Columbia-0 (Col-0) дикого типа, ap2-7 и Col FRI San Feliu-2 (Sf-2) (Lee and Amasino, 1995).Мутант ap2-7 был скрещен с Col FRI Sf-2, и растения FRI ap2-7 были выделены из самоопыленного потомства F 2 , которое показало гомеотические дефекты ap2 и позднее цветение.

Для экспериментов по продолжительности цветения Arabidopsis общее количество листьев (розеточных и стеблевых листьев) подсчитывали в момент раскрытия первого цветка.

Конструирование плазмид и трансформация растений

Для получения трансгенного растения ap2-7 PEP2 –VENUS a 7.Геномная область PEP2 размером 4 т.п.н., охватывающая 4 т.п.н. выше начала трансляции и 1195 п.н. ниже остановки трансляции, была клонирована с помощью ПЦР (номер доступа NCBI LT669794.1). Впоследствии кодирующая последовательность VENUS: 9Ala была вставлена ​​либо после ATG, либо перед кодоном STOP PEP2 с использованием метода неполного удлинения праймера полимеразой (PIPE) (Klock et al. , 2008). Праймеры, используемые для клонирования PIPE, суммированы в дополнительной таблице S1 на сайте JXB онлайн.Сгенерированные фрагменты рекомбинантной ДНК были интегрированы в бинарный вектор pEarlyGate301 и трансформированы в Col с помощью Agrobacterium -опосредованного цветочного дипа (Clough and Bent, 1998). Отобранные гомозиготные линии Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и Col ProPEP2 :: PEP2 :: VENUS C2-1-9 были скрещены с ap2-7 .

Анализ экспрессии генов

Анализ экспрессии гена

проводили для генов дикого типа, pep1-1, и pep2-1. Для образцов pep2-1 гомозиготные растения были отобраны после генотипирования из сегрегированной популяции с использованием расщепленного амплифицированного полиморфного (CAP) маркера (прямой праймер, CAGCTGCACGGTATGTTTTTC; обратный праймер, GCTTTGTCATAAGCCCTGTGde 0007 I0007 I0007).

Для анализа паттерна экспрессии PEP1 дикого типа и pep2-1 выращивали в течение 6 недель в LD и яровизировали в течение 12 недель. Верхушки основных побегов собирали перед яровизацией, во время яровизации и после яровизации (через 1, 2, 3 и 4 недели после возвращения растений к теплым температурам).Подмышечные вегетативные верхушки собирали с растений, растущих в ЛД через 2, 3 и 4 недели после яровизации. В каждом образце было объединено в среднем 10 вершин.

Экспрессия транскриптов PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY и AaAP1 в молодых и взрослых транскриптах pep2 и -1-1 pep2 и -1 был обнаружен в проростках, выращенных в течение 3 недель (молодые) или 6 недель (взрослые) в LD и яровизированных в течение 12 недель.Верхушки основных побегов собирали перед яровизацией и в холодное время года на 4, 8 и 12 неделях яровизации. Для анализа AaSPL5 , AaSPL9 , AaSPL15 и miR156 верхушка главного побега была собрана с 3-, 4- и 6-недельных растений дикого типа и pep2-1 растений, растущих в LD. . В каждом образце было объединено в среднем 14 вершин. Уровни экспрессии были нормализованы как для AaPP2A , так и для AaRAN3 , за исключением miR156, который был нормализован до SnoR101.

Экспрессия транскрипта FLC была проанализирована в верхушке побега растений FRI и FRI ap2-7 , выращенных в течение 10 дней перед яровизацией, в течение 40 дней яровизации и через 10 дней и 20 дней после возвращения к яровизации. Условия теплицы LD. Уровни экспрессии были нормализованы до UBC21 . Общую РНК растений экстрагировали с помощью набора RNeasy Plant Mini (Qiagen), а обработку ДНКазой выполняли с помощью набора Ambion, не содержащего ДНК (Invitrogen), для уменьшения любого загрязнения ДНК.Тотальную РНК (1,5 мкг) использовали для синтеза кДНК посредством обратной транскрипции с использованием обратной транскриптазы SuperScript II (Invitrogen) и oligo dT (18) в качестве праймера. Аликвоту 2 мкл разведения кДНК (1: 5) использовали в качестве матрицы для каждой количественной ПЦР (qPCR). Для анализа miR156 и SPL s общая РНК была экстрагирована с использованием miRNeasy ® Mini Kit (Qiagen), а обработка ДНКазой была выполнена с помощью набора Ambion DNA-Free (Invitrogen) для уменьшения загрязнения ДНК. Аликвоту РНК 200 нг использовали для обратной транскрипции miR156 и SnoR101 с использованием праймеров, специфичных для miR156 и SnoR101.qPCR выполняли с использованием системы реального времени CFX96 и CFX384 (Bio-Rad) и системы детекции iQ SYBR Green Supermix. Каждая точка данных была получена из двух или трех независимых биологических повторов и показана как среднее ± стандартное отклонение.

Праймеры, использованные для количественной ПЦР для PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY , AaAP1 , Aa0007 AaSPL5 A6, 9SPL9, 9SPL5 , miR156 и SnoR101 были описаны ранее (Wang et al., 2009, 2011; Bergonzi et al., 2013; Mateos et al. , 2017; Lazaro et al. , 2018). Праймеры, использованные для количественной ПЦР для FLC и UBC21 , также были описаны в другом месте (Chechowski et al. , 2005; Crevillen et al. , 2013).

Статистический анализ

Статистический анализ проводился с использованием программного обеспечения R. Чтобы обнаружить значительные различия в экспрессии генов, мы установили коэффициент ложного обнаружения (FDR), равный 0.05 при проведении множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P . Процедуры со значительными различиями обозначаются буквами или звездочками. Для физиологического анализа pep2-1 мы провели несколько попарных тестов Бонферрони (α = 0,05) для выявления значительных различий между диким типом и pep2-1 . Здесь непараметрический тест не может быть проведен из-за связей, созданных во время присвоения ранга.

РНК-анализ

Для анализа дифференциальной экспрессии генов мы использовали метод секвенирования РНК (RNAseq) на верхушках 3-недельного дикого типа и мутантов pep2-1 и pep1-1 . pep2-1. гомозиготных растений генотипировали из сегрегационной популяции с использованием маркера CAP, описанного выше. РНК выделяли, как описано выше, и полную целостность РНК подтверждали на Agilent BioAnalyzer. Подготовка библиотеки и секвенирование были выполнены в Центре генома Макса Планка в Кельне, Германия (https://mpgc.mpipz.mpg.de/home/). RNAseq выполняли с тремя биологическими повторами на образец. Библиотеки готовили из 1 мг тотальной РНК с использованием набора TruSeq RNA (Illumina) и секвенировали односторонние чтения 100 пар оснований на HiSeq2500 (Illumina).Считывания из всех образцов были картированы на эталонном геноме A. alpina (Willing et al. , 2015) с использованием TopHat (Trapnell et al. , 2009) с параметрами по умолчанию. Впоследствии CuffDiff (Trapnell et al. , 2010) использовался для оценки уровня мРНК каждого гена путем вычисления количества фрагментов на килобазу экзонной модели на миллион отображенных считываний (FPKM). Для расчета дифференциальной экспрессии генов среди образцов использовали значения FPKM. Log 2 -кратное изменение (L 2 FC) ≥1 для генов с повышенной регуляцией и L 2 FC ≤ –1 для генов с пониженной регуляцией, оба имеют значение q (скорректировано P - значение) ≤0.05, был использован для дальнейшего анализа.

Обогащение онтологии генов

(GO) было выполнено с помощью подключаемого модуля BiNGO (Maere et al. , 2005), реализованного в Cytoscape V3.5.1 (Cline et al. , 2007). Для определения обогащенных генов применялся гипергеометрический тест, а для ограничения количества ложноположительных результатов выполнялась коррекция FDR Бенджамини-Хохберга (Benjamini and Hochberg, 1995). FDR был установлен на 0,05.

Данные о секвенировании этого исследования были депонированы в Gene Expression Omnibus (GEO) под номером доступа GSE117977.Последовательности изученных генов можно найти в базах данных GenBank / EMBL под следующими номерами доступа: PEP2 (AALP_AA7G245300), кДНК PEP1 (FJ755930), кодирующая последовательность AaLFY (кодирующая последовательность AaLFY (JF436956), JF436956), (JF436957), AaAP1 (KFK41337.1), кодирующая последовательность AaTFL1 (JF436953) и AaFUL (KFK27856.1).

Результаты

PEP2 влияет на экспрессию генов, участвующих во многих физиологических реакциях и ответах развития растений, включая цветение

Для обзора роли PEP2 в A.alpina мы провели анализ RNAseq. Мы сравнили транскриптомы верхушек 3-недельных мутантов pep2-1 и pep1-1 с диким типом (Pajares). Трехнедельные растения дикого типа и мутантные растения являются вегетативными и не претерпели перехода к цветению (Wang et al. , 2011; Bergonzi et al. , 2013; Park et al. , 2017; Lazaro и др. , 2018). Среди транскриптомов большинство дифференциально экспрессируемых генов было обнаружено в pep2-1 .В общей сложности 253 гена были активированы, а 223 гена были подавлены в pep2-1 по сравнению с диким типом (фиг. 1A, B; дополнительный набор данных S1). Напротив, только 47 генов были активированы, а 98 генов подавлены в pep1-1 по сравнению с диким типом (рис. 1A, B; дополнительный набор данных S2). На гены, по-разному экспрессируемые между pep1-1 и диким типом, влияет PEP1 , тогда как на гены, дифференциально экспрессируемые между pep2-1 и диким типом, влияет PEP2 как через PEP1, -зависимые, так и PEP1 -независимый путь.Чтобы идентифицировать гены, на которые влияет PEP2 через PEP1 -независимый путь, мы сравнили транскриптомы pep2-1 с pep1-1 (рис. 1C, D; дополнительный набор данных S3). В общей сложности 504 гена были значительно активированы, а 251 ген был значительно подавлен в pep2-1 по сравнению с pep1-1 (фиг. 1C, D). Интересно, что количество дифференциально экспрессируемых генов, обнаруженных между pep2-1 и pep1-1 , было выше, чем количество генов, обнаруженных при сравнении отдельных мутантов с диким типом.Анализ GO показал, что наиболее обогащенной категорией для активируемых генов в pep2-1 по сравнению с диким типом и в pep2-1 по сравнению с pep1-1 был биосинтез глюкозинолатов, которые участвуют в защите. против нападения травоядных и патогенов (дополнительный рисунок S1) (Keith and Mitchell-Olds, 2017). Перекрытие в чрезмерно представленных категориях ГО в наборе генов, активируемых в pep2-1 , по сравнению либо с диким типом, либо с мутантом pep1-1 было очень высоким, что и следовало ожидать, поскольку было больше генов. Повышенная регуляция в pep2-1 по сравнению с диким типом, чем в pep1-1 по сравнению с диким типом (рис.1А; Дополнительный рис. S1A, B). Среди обычно обогащенных категорий генов с пониженной регуляцией в pep2-1 мы обнаружили апоптоз и десумоилирование белка (дополнительный рисунок S1C, D).

Рис. 1.

Дифференциально экспрессируемые гены у pep2 и pep1 мутантов A. alpina . (A и B) Диаграмма Венна для значительно активированных (A) и подавленных (B) генов в pep2-1 по сравнению с диким типом (WT) и pep1-1 по сравнению с WT.(C и D) Диаграмма Венна для значительно активированных (C) и подавленных (D) генов в pep2-1 по сравнению с WT и в pep2-1 по сравнению с pep1-1. (E – G) Гены времени цветения по-разному экспрессируются в pep2-1 по сравнению с WT (E), pep1-1, по сравнению с WT (F) и pep2-1 по сравнению с pep1-1 (Г). Значения экспрессии основаны на RNAseq.

Рис. 1.

Дифференциально экспрессируемые гены в pep2 и pep1 A.alpina мутанты. (A и B) Диаграмма Венна для значительно активированных (A) и подавленных (B) генов в pep2-1 по сравнению с диким типом (WT) и pep1-1 по сравнению с WT. (C и D) Диаграмма Венна для значительно активированных (C) и подавленных (D) генов в pep2-1 по сравнению с WT и в pep2-1 по сравнению с pep1-1. (E – G) Гены времени цветения по-разному экспрессируются в pep2-1 по сравнению с WT (E), pep1-1, по сравнению с WT (F) и pep2-1 по сравнению с pep1-1 (Г).Значения экспрессии основаны на RNAseq.

Цветочные активаторы и репрессоры были идентифицированы среди дифференциально экспрессируемых генов в pep2-1 . Например, ортолог A. alpina из SOC1 ( AaSOC1 ) был активирован в pep2-1 по сравнению с диким типом (рис. 1E; дополнительный набор данных S1). Этот эффект PEP2 на AaSOC1 проявляется через PEP1 , поскольку AaSOC1 по-разному выражался между pep1-1 и диким типом, но не в pep2-1 по сравнению с pep1-1 (рис.1F, G; Дополнительные наборы данных S2, S3; Mateos et al , 2017). Правила с AaSMZ по PEP2 отличаются от правил по PEP1 . AaSMZ был повышен в pep2-1 по сравнению с диким типом и подавлен в pep1-1 по сравнению с диким типом (фиг. 1E, F; дополнительные наборы данных S1, S2). Напротив, AaSPL15 был активирован в мутанте pep1-1 по сравнению с диким типом, а не в pep2-1 по сравнению с диким типом, что указывает на то, что PEP2 не контролирует экспрессию AaSPL15 ( Инжир.1E, F; Дополнительные наборы данных S1, S2). Среди генов времени цветения, участвующих в PEP1 -независимой роли PEP2 , были цветочные репрессоры AaTFL1 и AGAMOUS-LIKE 19 ( AaAGL19 ). AaTFL1 был подавлен, когда мы сравнили pep2-1 как с диким типом, так и с pep1-1 , предполагая, что эффект PEP2 на AaTFL1 не зависит от PEP1 (рис. 1E– G; Дополнительные наборы данных S1 – S3).Сходным образом AGAMOUS-LIKE 19 ( AaAGL19 ) транскриптов специфически подавлялись в мутанте pep2-1 (Fig. 1E-G; Supplementary Datasets S1-S3). Мы также обнаружили, что ортолог AaULP1c (убиквитин-подобная протеиназа), кодирующий протеазу SUMO, и CIS-CINNAMIC ACID-ENHANCED 1 ( AaZCE1 ) дифференциально специфично экспрессируется в pep2-1 (рис. 1C – E; дополнительные наборы данных S1, S2). Интересно, что как ULP1c , так и ZCE1 у Arabidopsis контролируют цветение посредством FLC .Мутации в ULP1c и его гомологе ULP1d у Arabidopsis вызывают фенотип раннего цветения, который, по крайней мере частично, может быть обусловлен понижающей регуляцией FLC (Conti et al., 2008; Castro et al. , 2016). ZCE1 участвует в регуляции роста и развития растений с помощью цис -фенилпропаноидов, и было показано, что он контролирует время связывания посредством усиления экспрессии FLC (Guo et al. , 2011).

PEP2 может дополнять мутант Arabidopsis ap2

Как мутант pep2 у A. alpina , так и мутант ap2 у Arabidopsis демонстрируют раннее цветение и аналогичные дефекты цветков, включая отсутствие лепестков и трансформацию чашелистиков в плодолистики (Bowman et al. , 1991 ; Bergonzi et al., 2013; Nördstrom et al. , 2013). Чтобы проверить, имеют ли оба гена общие функции, мы экспрессировали PEP2 в мутантном фоне ap2-7 под контролем его собственного промотора.Мы слили геномную область 7,4 т.п.н. PEP2 , охватывающую 4 т.п.н. выше начала трансляции и 1,2 т.п.н. ниже остановки трансляции, с флуоресцентным белком VENUS на N- или C-конце. Трансгенные линии были впервые получены на фоне Col. Гомозиготные линии, полученные для N-концевой VENUS (Col ProPEP2 :: VENUS :: PEP2 N6-1-3) и C-концевой VENUS (Col ProPEP2 :: PEP2 :: VENUS C2-1-9), были впоследствии перешел на ap2-7 . При выращивании в SD конструкции PEP2 дополняли фенотип раннего цветения мутанта ap2-7 (рис.2A – D). Более того, гомеотические дефекты мутанта ap2 были восстановлены с помощью PEP2 , что указывает на то, что ген A. alpina PEP2 контролирует время цветения и идентичность цветковых органов аналогично AP2 (рис. 2E – H). .

Рис. 2.

PEP2 может дополнять цветковый и цветочный фенотип мутанта Arabidopsis ap2-7 . (A и B) Фенотипы Col дикого типа, мутант ap2-7 , Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и ap2-7 ProPEP2 :: VENUS :: PEP2 Линии N6-1-3, выращенные в SD (A), и количество цветущих листьев (B).(C и D) Col, мутант ap2-7 , Col ProPEP2 :: PEP2 :: VENUS C2-1-9 и ap2-7 ProPEP2 :: PEP2 :: VENUS C2-1- 9 линий, выращенных в SD (C) и количество цветущих листьев (D). (A и C) Фотографии всего растения были сделаны через 57 дней после прорастания (DAG). Масштабная линейка = 3 см. В (B) и (D) буквы обозначают значимые различия между генотипами, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P (значение a 0,05).Планки погрешностей указывают стандартное отклонение. (E и F) Соцветие Col дикого типа (E) ap2-7 (F), ap2-7 ProPEP2 :: VENUS :: PEP2 N6-1-3 (G) и ap2-7 ProPEP2: : PEP2 :: VENUS C2-1-9 (H) записано 73 DAG в SD.

Рис. 2.

PEP2 может дополнять цветковый и цветочный фенотип мутанта Arabidopsis ap2-7 . (A и B) Фенотипы Col дикого типа, мутант ap2-7 , Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и ap2-7 ProPEP2 :: VENUS :: PEP2 Линии N6-1-3, выращенные в SD (A), и количество цветущих листьев (B).(C и D) Col, мутант ap2-7 , Col ProPEP2 :: PEP2 :: VENUS C2-1-9 и ap2-7 ProPEP2 :: PEP2 :: VENUS C2-1- 9 линий, выращенных в SD (C) и количество цветущих листьев (D). (A и C) Фотографии всего растения были сделаны через 57 дней после прорастания (DAG). Масштабная линейка = 3 см. В (B) и (D) буквы обозначают значимые различия между генотипами, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P (значение a 0,05).Планки погрешностей указывают стандартное отклонение. (E и F) Соцветие Col дикого типа (E) ap2-7 (F), ap2-7 ProPEP2 :: VENUS :: PEP2 N6-1-3 (G) и ap2-7 ProPEP2: : PEP2 :: VENUS C2-1-9 (H) записано 73 DAG в SD.

Чтобы проверить, сохраняется ли эффект PEP2 на экспрессию PEP1 в Arabidopsis для AP2 и FLC , мы объединили мутацию ap2-7 с сильным аллелем FRI из San Feliu- 2 (Sf-2), который усиливает экспрессию Col FLC .Хотя мутация ap2 ускоряла цветение на фоне FRI Sf-2, экспрессия FLC не изменялась в верхушках этих растений на разных стадиях развития (до, во время или после 40 дней яровизации) ( Дополнительный рис. S2). Эти результаты показывают, что, хотя роль AP2 и PEP2 в регулировании времени цветения и идентичности цветковых органов сохраняется, AP2 не контролирует экспрессию FLC на фоне FRI Sf-2 (дополнительный рис.S2B).

PEP2 контролирует возрастную реакцию A. alpina на яровизацию

Затем мы исследовали, была ли PEP1 -независимая роль PEP2 сходной с ролью AP2 у Arabidopsis и, следовательно, регулировала ли она цветение по возрастному пути. Сначала мы проанализировали накопление miR156 и уровень транскрипции A. alpina SPL5 , 9 и 15 ( AaSPL5, 9 и 15 ) в вершинах pep2-1 и . проростки дикого типа, выращенные в течение 3, 4 и 6 недель в LD (дополнительный рис.S3). Накопление miR156 в верхушке побега снижалось у более старых проростков, но сходная картина наблюдалась у pep2-1 и дикого типа (дополнительный рисунок S3A). Уровни транскрипта AaSPL5 , 9 и 15 увеличивались по мере старения растений (дополнительный рисунок S3B – D). Для AaSPL5 и 15 мы не наблюдали значительных различий между pep2-1 и диким типом, тогда как уровни мРНК AaSPL9 различались между двумя генотипами только у 6-недельных проростков (дополнительный рис.S3B – D). Эти результаты согласуются с предыдущими исследованиями на Arabidopsis, демонстрирующими, что AP2 контролирует цветение по возрастному пути, расположенному ниже генов miR156 и SPL . Поскольку ранее было показано, что возрастное влияние на цветение у A. alpina проявляется только после яровизации (Wang et al. , 2011; Bergonzi et al. , 2013), мы проверили, соответствует ли PEP2 играет возрастную роль у яровизированных растений. Для этого мы яровировали 3-недельные проростки дикого типа и pep2-1 в течение 12 недель и измерили время цветения после возвращения к теплым температурам.Мы также включили в этот эксперимент мутант pep1-1 , чтобы исключить PEP1 -зависимый эффект PEP2 на время цветения. Согласно предыдущим исследованиям, в этих условиях дикий тип не цвел после яровизации, а рос только вегетативно (рис. 3; Wang et al. , 2011; Bergonzi et al ., 2013). Интересно, что pep2-1 зацвело в среднем 18 листьев и через 17 дней после яровизации, тогда как яровизированное pep1-1 зацвело 27 листьями, аналогично не яровизированным растениям pep1-1 , непрерывно выращиваемым в LD (рис.3; Дополнительный рис. S4; Ван и др. , 2009 г .; Bergonzi et al. , 2013). Эти данные свидетельствуют о том, что яровизация ускоряет цветение у молодых растений pep2-1 , но не у pep1-1 растений. Фенотип времени цветения у мутантов также отличается от фенотипа в LDs, когда pep1-1 цветут раньше, чем pep2-1 (Bergonzi et al. , 2013). В целом, эти результаты предполагают, что PEP2 регулирует зависимый от возраста ответ на яровизацию PEP1 -независимым образом.

Рис. 3.

PEP2 регулирует возрастную реакцию A. alpina на яровизацию. (A) Изображение 3-недельного дикого типа (WT), pep1-1 и pep2-1 , яровизированных в течение 12 недель с последующими 2 неделями в LD. Масштабная линейка = 5 см. (B) Время цветения показано как количество листьев при цветении 3-недельного WT, pep1-1 и pep2-1 , яровизированных в течение 12 недель. WT не цвести (NF).Звездочка означает значительную разницу в общем количестве листьев, определенном с помощью теста Стьюдента t ( P -значение <0,01). Планки погрешностей указывают стандартное отклонение.

Рис. 3.

PEP2 регулирует возрастную реакцию A. alpina на яровизацию. (A) Изображение 3-недельного дикого типа (WT), pep1-1 и pep2-1 , яровизированных в течение 12 недель с последующими 2 неделями в LD. Масштабная линейка = 5 см. (B) Время цветения показано как количество листьев при цветении 3-недельного WT, pep1-1 и pep2-1 , яровизированных в течение 12 недель.WT не цвести (NF). Звездочка означает значительную разницу в общем количестве листьев, определенном с помощью теста Стьюдента t ( P -значение <0,01). Планки погрешностей указывают стандартное отклонение.

Чтобы понять, как молодые растения pep2-1 ускоряют цветение в ответ на яровизацию, мы проанализировали экспрессию PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY a и AaLFY a.Трехнедельные верхушки дикого типа pep2-1 и pep1-1 с главного побега собирали до и во время яровизации на 4, 8 и 12 неделях. В соответствии с предыдущими результатами, полученными на проростках, неяровизированные трехнедельные растения pep2-1 показали более низкие уровни мРНК PEP1 , чем у дикого типа (рис. 4A; Bergonzi et al. , 2013). Тем не менее, транскрипт PEP1 снижался аналогичным образом в pep2-1 и растениях дикого типа, а PEP1 заглушался через 4 недели на холоду (рис.4А). Эти данные позволяют предположить, что, несмотря на исходное различие в экспрессии PEP1 , отсутствие PEP2 не влияет на транскрипцию PEP1 в молодых вершинах во время яровизации. Экспрессия AaSOC1 постепенно повышалась во время яровизации, следуя той же схеме для трех генотипов (рис. 4B). Напротив, AaFUL , AaLFY и AaAP1 показали дифференциальное увеличение у дикого типа и мутантов через 8 и 12 недель яровизации (рис.4C, E, F). В молодых растениях дикого типа уровни мРНК AaFUL , AaLFY и AaAP1 не повышались, что указывает на то, что цветение еще не началось (рис. 4C, E, F). Более того, мутант pep2-1 показал более высокие уровни AaLFY и AaAP1 , чем pep1-1 после 12 недель яровизации (фиг. 3, 4E, F). Интересно, что мутант pep2-1 также показал сниженную экспрессию AaTFL1 в конце обработки холодом по сравнению с pep1-1 (рис.4D). Взятые вместе, наши результаты показывают, что PEP2 активирует AaTFL1 и репрессирует AaFUL , AaLFY и AaAP1 в молодых вершинах во время яровизации (рис. 3). Эта роль PEP2 не зависит от PEP1 , учитывая, что pep1-1 растений, яровизированных в молодом возрасте, зацвело позже, чем pep2-1 , и что экспрессия PEP1 была снижена в такой же степени у дикого типа. и pep2-1 во время яровизации (рис. 3, 4А).

Рис. 4.

PEP2 регулирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации. Относительная экспрессия PEP1 (A), AaSOC1 (B), AaFUL (C), AaTFL1 (D), AaLFY (E) и AaAP1 (F). Трехнедельные верхушки побегов дикого типа (WT), pep1-1 и pep2-1 собирали до и в течение 12 недель яровизации.Буквы обозначают существенные различия между WT, pep1-1 и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Графики без букв не показывают существенных различий. Планки погрешностей указывают стандартное отклонение.

Рис. 4.

PEP2 регулирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации.Относительная экспрессия PEP1 (A), AaSOC1 (B), AaFUL (C), AaTFL1 (D), AaLFY (E) и AaAP1 (F). Трехнедельные верхушки побегов дикого типа (WT), pep1-1 и pep2-1 собирали до и в течение 12 недель яровизации. Буквы обозначают значительные различия между WT, pep1-1 и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0.05). Графики без букв не показывают существенных различий. Планки погрешностей указывают стандартное отклонение.

Чтобы выяснить, консервативна ли регуляция этих генов идентичности меристем цветков с помощью PEP2 у взрослых растений, мы протестировали экспрессию AaFUL , AaLFY и AaAP1 во время яровизации. Шестинедельные растения дикого типа и растения pep2-1 подвергались 12-недельному воздействию холода, и уровни мРНК AaLFY , AaAP1 и AaFUL были проанализированы в верхушке побега перед яровизацией и 1, Через 3, 5, 8 и 12 недель яровизации.Уровни мРНК AaFUL были выше у pep2-1 , чем у дикого типа уже после 8 недель яровизации (дополнительный рисунок S4A). Для экспрессии AaLFY и AaAP1 значительное увеличение наблюдалось у мутанта pep2-1 только в конце 12 недель холода (дополнительный рисунок S4B, C). В целом, эти результаты предполагают, что PEP2 задерживает цветение, подавляя AaFUL , AaLFY и AaAP1 в конце 12 недель яровизации, когда PEP1 уже подавлялись в верхушках обоих молодых и взрослые растения.

PEP2 требуется для активации экспрессии PEP1 после яровизации

Чтобы проверить PEP1 -зависимую роль PEP2 , мы подвергли мутант pep2-1 и растения дикого типа разной продолжительности яровизации. Оба генотипа выращивали в течение 5 недель в LD, яровизировали в течение 8, 12, 18 и 21 недель и переносили обратно в тепличные условия LD (рис. 5A, B). Мутант pep2-1 показал сокращение количества дней до появления цветков по сравнению с диким типом при любой продолжительности холода (рис.5С). Кроме того, соцветия в pep2-1 показали снижение фенотипов реверсии цветков и усиление приверженности ветвей соцветий к цветению (рис. 5D-G). Эти результаты показывают, что PEP2 контролирует время цветения и архитектуру соцветий у A. alpina . Однако ответ pep2-1 все еще варьировался в зависимости от продолжительности яровизации, что позволяет предположить, что другие цветочные репрессоры могут вносить вклад в цветение в ответ на яровизацию.Кроме того, PEP2 требуется для поддержания пазушных побегов, которые расположены чуть ниже соцветия в вегетативном состоянии, поскольку все пазушные ветви мутанта pep2-1 участвуют в репродуктивном развитии (рис. 5; Bergonzi et al. , 2013).

Как было показано ранее для дикого типа, мРНК PEP1 активируется в апикальной меристеме побега главного побега после ненасыщающей яровизации (рис. 6; Wang et al. , 2009; Lazaro et al. al., 2018). Это нестабильное молчание мРНК PEP1 после холода было устранено у мутанта pep2-1 , что позволяет предположить, что PEP2 требуется для активации экспрессии PEP1 в апикальной меристеме побега после недостаточной яровизации (рис. 6). Роль PEP2 в активации PEP1 после яровизации также наблюдается в подмышечных ветвях. Все пазушные ветви мутанта pep2-1 готовы к цветению (рис.5B) и показали очень низкую экспрессию PEP1 по сравнению с вегетативными ветвями дикого типа (фиг. 6). Эти результаты предполагают, что основной вклад PEP2 заключается в активации транскрипции PEP1 после яровизации как в апикальной меристеме побега, так и в вегетативных подмышечных ветвях.

Рис. 5.

Мутантные растения pep2 зацветают раньше, чем растения дикого типа, и демонстрируют пониженные реверсивные фенотипы. (A) Растения дикого типа (WT), подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD.(B) pep2-1 мутантных растений, подвергнутых яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD. Масштабная линейка = 10 см. (C) Время до появления цветков растений WT и pep2-1 , подвергшихся разной продолжительности яровизации, измеренное как количество дней до первого распускающегося цветка. (D) Процент цветущих ветвей соцветия (FB) у WT и мутанта pep2-1 , подвергшихся 8, 12, 18 и 21 неделям яровизации в момент раскрытия последнего цветка в соцветии.(E) WT перевернутое соцветие у растений, яровизированных в течение 8 недель. (F) pep2-1 мутантное соцветие в растениях, яровизированных в течение 8 недель. Масштабная линейка = 2 см. (G) Количество прицветников в соцветии WT и мутанта pep2-1 , подвергшихся яровизации в течение 8, 12, 18 и 21 недель во время раскрытия последнего цветка в соцветии. Этот эксперимент был проведен вместе с мутантом pep1-1 в ранее опубликованном эксперименте (рис. 6 в Lazaro et al., 2018). Данные для контроля WT в двух статьях аналогичны. Звездочки обозначают значительные различия между диким типом и мутантом pep2-1 в каждый момент времени, определенный с помощью множественных попарных тестов Бонферрони (α-значение 0,05). Планки погрешностей указывают стандартное отклонение.

Рис. 5.

Мутантные растения pep2 зацветают раньше, чем растения дикого типа, и демонстрируют пониженные реверсивные фенотипы. (A) Растения дикого типа (WT), подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD.(B) pep2-1 мутантных растений, подвергнутых яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD. Масштабная линейка = 10 см. (C) Время до появления цветков растений WT и pep2-1 , подвергшихся разной продолжительности яровизации, измеренное как количество дней до первого распускающегося цветка. (D) Процент цветущих ветвей соцветия (FB) у WT и мутанта pep2-1 , подвергшихся 8, 12, 18 и 21 неделям яровизации в момент раскрытия последнего цветка в соцветии.(E) WT перевернутое соцветие у растений, яровизированных в течение 8 недель. (F) pep2-1 мутантное соцветие в растениях, яровизированных в течение 8 недель. Масштабная линейка = 2 см. (G) Количество прицветников в соцветии WT и мутанта pep2-1 , подвергшихся яровизации в течение 8, 12, 18 и 21 недель во время раскрытия последнего цветка в соцветии. Этот эксперимент был проведен вместе с мутантом pep1-1 в ранее опубликованном эксперименте (рис. 6 в Lazaro et al., 2018). Данные для контроля WT в двух статьях аналогичны. Звездочки обозначают значительные различия между диким типом и мутантом pep2-1 в каждый момент времени, определенный с помощью множественных попарных тестов Бонферрони (α-значение 0,05). Планки погрешностей указывают стандартное отклонение.

Рис. 6.

PEP2 требуется для активации экспрессии PEP1 после яровизации. Относительная экспрессия PEP1 в апикальной меристеме побега и в вегетативных подмышечных меристемах дикого типа (WT) и мутанта pep2-1 до, во время и после 12 недель яровизации.Буквы обозначают существенные различия между WT и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Подробную информацию о существенных различиях можно найти в дополнительной таблице S3. Планки погрешностей указывают стандартное отклонение.

Рис. 6.

PEP2 требуется для активации экспрессии PEP1 после яровизации. Относительная экспрессия PEP1 в апикальной меристеме побега и в вегетативных подмышечных меристемах дикого типа (WT) и мутанта pep2-1 до, во время и после 12 недель яровизации.Буквы обозначают существенные различия между WT и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Подробную информацию о существенных различиях можно найти в дополнительной таблице S3. Планки погрешностей указывают стандартное отклонение.

Обсуждение

Понимание роли длительного воздействия низких температур на цветение имеет особое значение для многолетних видов, которые будут перезимовать несколько раз в течение своего жизненного цикла.У многолетников умеренного климата длительное воздействие холода контролирует более поздние стадии цветения, такие как равномерное распускание почек весной, тогда как у альпийских видов оно обеспечивает формирование цветков до того, как растения попадут в благоприятные условия окружающей среды для цветения (Diggle, 1997; Meloche and Diggle, 2001; Lazaro и др. , 2018). Поддержание вегетативного развития после цветения, которое важно для стратегии многолетней жизни, регулируется сезонным циклом репрессоров цветов и дифференциальным ответом меристем на индукционные стимулы цветка из-за возрастных факторов (Wang et al., 2009, 2011; Koskela et al. , 2012). Здесь мы охарактеризовали роль репрессора цветов A. alpina PEP2 , ортолога Arabidopsis AP2. Предыдущие исследования показали, что PEP2 контролирует цветение посредством PEP1 -зависимого и PEP1 -независимого пути (Bergonzi et al ., 2013). Наш транскриптомный анализ показал, что PEP2 влияет на экспрессию генов, участвующих в нескольких процессах развития.Однако многие из идентифицированных генов могут регулироваться не напрямую с помощью PEP2, а посредством сложных последующих генетических взаимодействий (Fig. 1; Supplementary Fig. S1). Мы также обнаружили, что промоторы и репрессоры растений по-разному экспрессируются в мутанте pep2 . В Arabidopsis белок AP2 был иммунопреципитирован из промоторной области SOC1 (Yant et al. , 2010). Однако в нашем исследовании эффект PEP2 на AaSOC1 , по-видимому, проявляется через PEP1 (рис.1). Чтобы охарактеризовать роль PEP1 -зависимой и PEP1 -независимой роли PEP2 в цветении, мы также использовали физиологический анализ и проследили экспрессию генов времени цветения и идентичности меристем в течение жизненного цикла A. alpina . Эти данные показали, что PEP2 контролирует (i) возрастную реакцию на яровизацию и (ii) временные циклы репрессора цветов PEP1 , обеспечивая активацию экспрессии PEP1 после яровизации.

PEP2 контролирует возрастную реакцию на яровизацию

PEP2 может спасти фенотип раннего цветения мутанта Arabidopsis ap2-7 , предполагая, что его роль во времени цветения может быть сохранена (рис. 2). У Arabidopsis AP2 посттранскрипционно регулируется miR172, а miR172b помещается в возрастной путь, поскольку он транскрипционно контролируется мишенями miR156 SPL9 и SPL15 (Wu et al., 2009 г .; Hyun et al. , 2016). AP2 также негативно регулирует свою экспрессию, напрямую связываясь со своим собственным локусом генома, а также с локусами своих регуляторов miR156e , miR172b и FUL , что позволяет предположить, что AP2 транскрипционно регулируется множеством петель обратной связи (Schwab и др. , 2005; Янт и др. , 2010; Balanza и др. ., 2018). Белок AP2 был также иммунопреципитирован из хроматина цветочных интеграторов и генов, необходимых для развития цветочной меристемы, таких как SOC1 , AGAMOUS ( AG ) и AP1 (Yant et al., 2010). Транскрипция генов, таких как SOC1 и FUL , также контролируется вышестоящими регуляторами возрастного пути. Сообщалось, что SPL9 связывается с первым интроном SOC1 , а SPL15 - с FUL и miR172b (Wang et al. , 2009; Hyun et al. , 2016). В целом, эта сложная генетическая цепь, включающая AP2, может способствовать быстрому жизненному циклу Arabidopsis, в котором переход цветков происходит вскоре после приобретения репродуктивной способности.В отличие от Arabidopsis, у A. alpina репродуктивная способность не связана с началом цветения. Arabis alpina растения становятся способными к цветению после 5 недель выращивания в условиях LD, но начинают цветение только тогда, когда они подвергаются яровизации (Wang et al. , 2009). Это говорит о том, что цветение у A. alpina регулируется тесным взаимодействием между возрастом и путями яровизации. Члены семейств SPL и AP2 (e.грамм. AaSPL15 и AaTOE2 ) транскрипционно репрессируются PEP1 в дополнение к посттранскрипционной и посттрансляционной регуляции miRNA (Chen, 2004; Bergonzi et al. ., 2013; Hyun et al. , 2016). ; Сюй и др. , 2016; Матеос и др. , 2017). Хотя FLC у Arabidopsis нацелены на аналогичный набор генов, сильное взаимодействие между возрастом и путем яровизации наиболее очевидно у A. alpina (Deng et al., 2011; Mateos et al. , 2017). Яровизация в A. alpina обеспечивает условия, при которых влияние возраста на цветение становится очевидным, поскольку он заглушает PEP1 . Постепенные изменения в накоплении miR156 и экспрессии генов SPL можно наблюдать в верхушке побега растений A. alpina , которые стареют в LDs (Bergonzi et al ., 2013). Однако накопление нижестоящих регуляторов в пути старения, таких как miR172, увеличивается только на верхушке побега во время яровизации и при переходе от цветков (Bergonzi et al ., 2013). Здесь мы показываем, что экспрессия miR156 и AaSPL5 и 15 не влияет на pep2 растений, выращенных в LDs (Fig. 1E-G; Supplementary Fig. S3). Учитывая, что PEP2 частично действует через PEP1 , отсутствие эффекта у pep2-1 на AaSPL15 может быть связано либо с остаточной экспрессией PEP1 в мутанте pep2-1 , либо с существованием компенсаторных генетических механизмов. Интересно, что уровни мРНК AaSPL9 были снижены у 6-недельных проростков pep2-1 по сравнению с проростками дикого типа (дополнительный рис.S3). Этот эффект PEP2 на AaSPL9 , однако, не может быть объяснен петлями обратной связи, описанными у Arabidopsis, поскольку ожидается, что уровни транскрипта AaSPL9 будут выше у pep2-1 , чем у дикого типа (дополнительный рис. S3; Янт и др. , 2010).

Ортолог A. alpina из TFL1 ( AaTFL1 ), как сообщалось ранее, влияет на эффект яровизации в зависимости от возраста, хотя его характер экспрессии не различается между ювенильными и взрослыми верхушками до яровизации ( Ван и др., 2011). Здесь мы показываем, что яровизация ускоряла цветение у молодых проростков pep2-1 по сравнению с pep1-1 , предполагая, что PEP2 также регулирует возрастную реакцию на яровизацию в PEP1 -независимом пути (рис. 3) . Интересно, что в нашем анализе RNAseq транскриптов AaTFL1 были уменьшены в мутанте pep2-1 , что позволяет предположить, что PEP2 вместе или через AaTFL1 устанавливает возрастной порог для цветения в ответ на яровизацию.Однако одно из основных различий между AaTFL1 и PEP2 состоит в том, что линии с пониженной активностью AaTFL1 не зацветают без яровизации. Эти результаты предполагают, что PEP2 играет дополнительную роль в регуляции времени цветения у A. alpina . Транскриптомные эксперименты на Arabidopsis также показали, что мРНК TFL1 подавляется в соцветиях ap2 по сравнению с диким типом (Yant et al. , 2010).Однако ChIP-Seq не обнаружил прямого связывания AP2 с локусом TFL1 , и поэтому неясно, есть ли прямой или косвенный эффект AP2 на транскрипцию TFL1 (Yant et al. , 2010). .

PEP2 обеспечивает активацию PEP1 после яровизации

Предыдущие исследования на A. alpina продемонстрировали, что PEP2 контролирует цветение в ответ на яровизацию посредством усиления экспрессии PEP1 (Bergonzi et al ., 2013). Здесь мы показываем, что основная роль PEP2 в активации PEP1 происходит после яровизации. Экспрессия PEP1 в A. alpina временно подавляется во время длительного воздействия холода, чтобы определить судьбу соцветий, в то время как она высоко экспрессируется в пазушных ветвях после яровизации для подавления цветения (Wang et al. , 2009; Lazaro et al. , 2018). Недавно мы показали, что продолжительность яровизации влияет на реактивацию PEP1 на верхушке побега после возвращения к теплым температурам (Lazaro et al., 2018). Фенотипы, коррелированные с высокими уровнями мРНК PEP1 после яровизации (например, реверсия цветков и наличие вегетативных пазушных ветвей), почти отсутствовали у мутанта pep2-1 (рис.5; Lazaro et al. , 2018). Соответственно, уровни мРНК PEP1 были снижены у яровизированных растений pep2-1 по сравнению с диким типом как в стебле соцветия, так и в пазушных ветвях (рис.6; Wang et al., 2009; Lazaro et al. ., 2018). Эти результаты предполагают, что PEP2 вносит вклад в жизненный цикл многолетнего растения и контролирует характерные для многолетнего растения признаки путем активации PEP1 после яровизации. У Arabidopsis интрогрессия аллеля FRI из образца Sf-2 в Col увеличивает продолжительность низких температур, необходимых для подавления FLC (Searle et al. , 2006). Образцы северного арабидопсиса, такие как Lov-1, требуют нескольких месяцев яровизации для достижения сайленсинга FLC и, как и A.alpina Pajares, более короткая продолжительность низких температур вызывает реактивацию FLC (Shindo et al. , 2006). Связь между AP2 и FLC у Arabidopsis не ясна. AP2 не связывается с локусом FLC в экспериментах ChIP-Seq, а в нашем исследовании экспрессия FLC не была изменена в растениях, где мутантный аллель ap2-7 был интрогрессирован в фон Col FRI Sf-2. (Дополнительный рис. S3; Янт и др., 2010). Однако, поскольку после яровизации наблюдалась самая сильная разница в экспрессии PEP1 в мутанте pep2-1 , следует проанализировать влияние AP2 в образце Lov-1, чтобы исключить роль AP2 на . Реактивация FLC после недостаточной яровизации.

Нестабильное молчание FLC включает изменения в накоплении триметилирования h4 по Lys27 (h4K27me3) (Angel et al. , 2011; Coustham et al., 2012). Паттерн метки h4K27me3 в локусе PEP1 также коррелирует с изменениями уровней мРНК PEP1 в A. alpina (Wang et al. , 2009). PEP1 показывает гораздо большее и более широкое увеличение h4K27me3 во время холода, чем FLC , а уровни h4K27me3 быстро снижаются на PEP1 после коротких периодов яровизации (Wang et al. , 2009; Angel et al. , 2011; Лазаро и др. , 2018).Хотя белки, регулирующие модификации гистонов в локусе PEP1 , неизвестны, сброс эпигенетической памяти FLC у Arabidopsis зависит от присутствия компонентов TrxG и деметилаз, содержащих домен Jumonji C (JmjC) EARLY FLOWERING 6 ( ELF6) и ОТНОСИТЕЛЬНО РАННЕГО ЦВЕТАНИЯ 6 (REF6) (Noh et al., 2004; Yun et al., 2011; Crevillen et al ., 2014). Было показано, что AP2 обладает способностью взаимодействовать с фактором ремоделирования хроматина HISTONE DEACETYLASE 19 (HDA19) для транскрипционной репрессии одной из своих мишеней (Krogan et al., 2012), но AP2 никогда не был связан с гистоновыми деметилазами.

Мы недавно продемонстрировали, что PEP1 стабильно подавляется в апикальной меристеме побегов взрослых растений, которые начинают цветение при длительном воздействии холода (Lazaro et al. , 2018). У молодых растений аналогичная продолжительность яровизации не приводит к цветению, даже если PEP1 заглушается во время холода (Lazaro et al. , 2018). Обязанность цветков во время яровизации коррелирует с более высокой экспрессией генов идентичности цветочной меристемы, AaFUL , AaLFY и AaAP1 , которые репрессируются PEP2 (Lazaro et al., 2018). Об этом свидетельствует преждевременная активация уровней мРНК AaFUL , AaLFY и AaAP1 в яровизированных растениях pep2-1 по сравнению с диким типом (рис. 4; дополнительный рис. S4). Хотя связь между сбросом PEP2 и PEP1 не ясна, похоже, что достижение приверженности цветков во время яровизации отрицательно коррелирует с повышением регуляции PEP1 после возврата к теплым температурам (Lazaro et al., 2018). У Arabidopsis не известно, что AP2 влияет на транскрипцию FLC . Однако сообщалось, что AP2 транскрипционно репрессируется с помощью FUL, а у растений, гиперэкспрессирующих FUL , наблюдается сниженная экспрессия FLC (Balanzà et al., 2014, 2018). Эти результаты предполагают, что FUL может регулировать транскрипцию FLC независимо или через AP2 . Это также может указывать на то, что в A. alpina роль PEP2 в экспрессии PEP1 может включать другие регуляторы времени цветения, гены, участвующие в пути возраста, и гены, обеспечивающие приверженность цветков во время яровизации.Однако, поскольку PEP1 также транскрипционно регулирует гены в этих генетических путях, также могут иметь место механизмы обратной связи (Mateos et al. , 2017).

Заключение

Наше исследование демонстрирует, что PEP2 играет инструментальную роль в A. alpina , контролируя возрастную реакцию на яровизацию и способствуя активации PEP1 после яровизации. Поскольку обе роли PEP2 сосредоточены на том, была ли достигнута приверженность цветению во время яровизации, можно предположить, что они не могут быть полностью независимыми.Вышестоящие регуляторы генов идентичности меристем цветков, такие как PEP2, могут контролировать реакцию на яровизацию индивидуальных меристем и вносить вклад в сложную архитектуру растений многолетних растений.

Дополнительные данные

Дополнительные данные доступны на сайте JXB онлайн.

Набор данных S1. Транскрипты, идентифицированные как дифференциально экспрессируемые в pep2-1 по сравнению с диким типом.

Набор данных S2. Транскрипты, идентифицированные как дифференциально экспрессируемые в pep1-1 по сравнению с диким типом.

Набор данных S3. Транскрипты, идентифицированные как дифференциально экспрессируемые в pep2-1 по сравнению с pep1-1 .

Рис. S1. GO-обогащенных категорий в эксперименте RNAseq.

Рис. S2. Активность AP2 не влияет на экспрессию FLC у Arabidopsis.

Фиг.S3. Уровни экспрессии miR156, AaSPL5 и AaSPL15 не различаются между растениями дикого типа и pep2-1 , растущими в длинные дни.

Рис. S4. PEP2 регулирует возрастную реакцию A. alpina на яровизацию.

Рис. S5. PEP2 контролирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации взрослых растений.

Таблица S1. Праймеры, используемые для PIPE-клонирования локуса PEP2 .

Таблица S2. Статистические различия на дополнительном рис. S2, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P , сравнивающих уровни мРНК FLC между FRI и FRI ap2-7 на разных стадиях развития.

Таблица S3. Статистические различия на фиг. 6 определены путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P , сравнивающих уровни мРНК PEP1 между pep2-1 и диким типом на разных стадиях развития.

Сокращения

    Сокращения

  • DAG

  • LD

  • SD

Благодарности

Мы хотели бы поблагодарить SPP1530 ​​и CEPLAS за финансирование MCA, SPP1529 за финансирование AP и KN, а также стипендию Purkyně от ASCR до AP. Мы также хотели бы поблагодарить Маргарет Кокс за критическое прочтение рукописи.

Список литературы

Амасино

Р

.

2009

.

Цветочная индукция и монокарпическая жизнь в сравнении с поликарпической

.

Биология генома

10

,

228

.

Angel

A

,

Song

J

,

Dean

C

,

Howard

M

.

2011

.

Переключатель на основе Polycomb, лежащий в основе количественной эпигенетической памяти

.

Природа

476

,

105

-

108

.

Аукерман

MJ

,

Сакаи

H

.

2003

.

Регулирование времени цветения и идентичности цветочных органов с помощью MicroRNA и ее APETALA2 -подобных генов-мишеней

.

Заводская ячейка

15

,

2730

-

2741

.

Balanzà

V

,

Martínez-Fernández

I

,

Ferrándiz

C

.

2014

.

Последовательное действие FRUITFULL как модулятора активности цветочных регуляторов SVP и SOC1

.

Журнал экспериментальной ботаники

65

,

1193

-

1203

.

Balanzà

V

,

Martínez-Fernández

I

,

Sato

S

,

Yanofsky

MF

,

Kaufmann

GC4

,

Феррандис

С

.

2018

.

Генетический контроль остановки меристемы и продолжительности жизни у арабидопсиса с помощью пути FRUITFULL – APETALA2

.

Nature Communications

9

,

565

.

Benjamini

Y

,

Hochberg

Y

.

1995

.

Контроль ложного обнаружения - практичный и эффективный подход к множественному тестированию

.

Журнал Королевского статистического общества B: Методологический

57

,

289

-

300

.

Bergonzi

S

,

Albani

MC

.

2011

.

Репродуктивная компетентность с ежегодной и постоянной точки зрения

.

Журнал экспериментальной ботаники

62

,

4415

-

4422

.

Bergonzi

S

,

Albani

MC

,

Ver Loren van Themaat

E

,

Nordström

KJ

,

Wang

R

e PD

,

Муфта

G

.

2013

.

Механизмы возрастной реакции на зимнюю температуру в многолетнем цветении Arabis alpina

.

Наука

340

,

1094

-

1097

.

Биллингс

WD

,

Муни

HA

.

1968

.

Экология арктических и альпийских растений

.

Биологические обзоры Кембриджского философского общества

43

,

481

-

529

.

Bowman

JL

,

Smyth

DR

,

Meyerowitz

EM

.

1991

.

Генетические взаимодействия между цветочными гомеотическими генами Arabidopsis

.

Девелопмент

112

,

1

-

20

.

Castro

PH

,

Couto

D

,

Freitas

S

и др.

2016

.

SUMO протеазы ULP1c и ULP1d необходимы для развития и реакции на осмотический стресс у Arabidopsis thaliana

.

Молекулярная биология растений

92

,

143

-

159

.

Чен

X

.

2004

.

МикроРНК как репрессор трансляции APETALA2 в развитии цветка Arabidopsis

.

Наука

303

,

2022

-

2025

.

Cline

MS

,

Smoot

M

,

Cerami

E

и др.

2007

.

Интеграция данных биологических сетей и экспрессии генов с использованием Cytoscape

.

Протоколы природы

2

,

2366

-

2382

.

Зажим

SJ

,

Изогнутый

AF

.

1998

.

Цветочное погружение: упрощенный метод трансформации Arabidopsis thaliana

, опосредованной Agrobacterium .

Заводской журнал

16

,

735

-

743

.

Conti

L

,

Цена

G

,

O’Donnell

E

,

Schwessinger

B

,

Dominy

P

,

Sadanandom

.

2008

.

Небольшие убиквитиноподобные протеазы-модификаторы, ЧРЕЗВЫЧАЙНО ТОЛЕПНЫЕ К SALT1 и -2, регулируют реакцию на солевой стресс у Arabidopsis

.

Заводская ячейка

20

,

2894

-

2908

.

Coustham

V

,

Li

P

,

Странно

A

,

Lister

C

,

Song

J

,

Dean

C

C

C

.

2012

.

Количественная модуляция сайленсинга поликомб лежит в основе естественной изменчивости яровизации

.

Наука

337

,

584

-

587

.

Crevillén

P

,

Sonmez

C

,

Wu

Z

,

Dean

C

.

2013

.

Генная петля, содержащая цветочный репрессор FLC, разрывается на ранней фазе яровизации

.

Журнал EMBO

32

,

140

-

148

.

Crevillén

P

,

Yang

H

,

Cui

X

,

Greeff

C

,

Уловка

M

,

9000 Qiu 9000 Ca4

Декан

С

.

2014

.

Эпигенетическое репрограммирование, предотвращающее наследование яровизированного состояния между поколениями

.

Природа

515

,

587

-

590

.

Czechwski

T

,

Stitt

M

,

Altmann

T

,

Udvardi

MK

,

Scheible

WR

.

2005

.

Идентификация и тестирование превосходных эталонных генов для нормализации транскриптов в геноме Arabidopsis

.

Физиология растений

139

,

5

-

17

.

Deng

WW

,

Ying

H

,

Helliwell

CA

,

Taylor

JM

,

Peacock

WJ

,

000

000 Dennis ES

.

2011

.

FLOWERING LOCUS C (FLC) регулирует пути развития на протяжении жизненного цикла Arabidopsis

.

Proceedings of the National Academy of Sciences, USA

108

,

6680

-

6685

.

Diggle

P

.

1997

.

Экстремальная преформация в альпийских условиях Polygonum viviparum : архитектурный анализ и анализ развития

.

Американский журнал ботаники

84

,

154

.

Guo

D

,

Wong

WS

,

Xu

WZ

,

Sun

FF

,

Qing

DJ

,

Li

N

2011

.

Ген 1, усиленный цис-коричной кислотой, играет роль в регуляции Arabidopsis bolting

.

Молекулярная биология растений

75

,

481

-

495

.

Hyun

Y

,

Richter

R

,

Vincent

C

,

Martinez-Gallegos

R

,

Porri

A

,

9.

2016

.

Многослойная регуляция SPL15 и сотрудничество с SOC1 интегрируют эндогенные пути цветения в меристеме побегов Arabidopsis

.

Клетка развития

37

,

254

-

266

.

Кейт

RA

,

Митчелл-Олдс

T

.

2017

.

Проверка гипотезы оптимальной защиты в природе: изменение профилей глюкозинолатов в растениях

.

PLoS One

12

,

e0180971

.

Klock

HE

,

Koesema

EJ

,

Knuth

MW

,

Lesley

SA

.

2008

.

Сочетание метода неполного удлинения праймера полимеразой для клонирования и мутагенеза с микропроцессором для ускорения усилий в области структурной геномики

.

Белки

71

,

982

-

994

.

Koskela

EA

,

Mouhu

K

,

Albani

MC

,

Kurokura

T

,

Rantanen

M

,

000 NH

,

000 NH

Coupland

G

,

Elomaa

P

,

Hytönen

T

.

2012

.

Мутация в TERMINAL FLOWER1 отменяет фотопериодические требования для цветения земляники Fragaria vesca

.

Физиология растений

159

,

1043

-

1054

.

Kotoda

N

,

Iwanami

H

,

Takahashi

S

,

Abe

K

.

2006

.

Антисмысловая экспрессия MdTFL1 , гена, подобного TFL1 , снижает ювенильную фазу у яблока

.

Журнал Американского общества садоводческих наук

131

,

74

-

81

.

Krogan

NT

,

Hogan

K

,

Long

JA

.

2012

.

APETALA2 негативно регулирует множественные гены идентичности органов цветка у Arabidopsis, рекрутируя корепрессор TOPLESS и гистондеацетилазу HDA19

.

Девелопмент

139

,

4180

-

4190

.

Lazaro

A

,

Obeng-Hinneh

E

,

Albani

MC

.

2018

.

Расширенная яровизация регулирует судьбу соцветий у Arabis alpina , стабильно подавляя PERPETUAL FLOWERING1

.

Физиология растений

176

,

2819

-

2833

.

Ли

I

,

Амасино

RM

.

1995

.

Влияние яровизации, фотопериода и качества света на фенотип цветения растений Arabidopsis , содержащих ген FRIGIDA

.

Физиология растений

108

,

157

-

162

.

Maere

S

,

Heymans

K

,

Kuiper

M

.

2005

.

BiNGO: плагин Cytoscape для оценки чрезмерной представленности категорий генной онтологии в биологических сетях

.

Биоинформатика

21

,

3448

-

3449

.

Mateos

JL

,

Tilmes

V

,

Madrigal

P

,

Severing

E

,

Richter

R

,

Rijter

Муфта

G

.

2017

.

Дивергенция регуляторных сетей, регулируемых ортологичными факторами транскрипции FLC и PEP1 у видов Brassicaceae

.

Proceedings of the National Academy of Sciences, USA

114

,

E11037

-

E11046

.

Mathieu

J

,

Yant

LJ

,

Mürdter

F

,

Küttner

F

,

Schmid

M

.

2009

.

Подавление цветения мишенью miR172 SMZ

.

PLoS Biology

7

,

e1000148

.

Meloche

CG

,

Diggle

PK

.

2001

.

Преформация, архитектурная сложность и гибкость развития у Acomastylis rossii (Rosaceae)

.

Американский журнал ботаники

88

,

980

-

991

.

Майклс

SD

,

Амасино

RM

.

1999

.

FLOWERING LOCUS C кодирует новый белок домена MADS, который действует как репрессор цветения

.

Заводская ячейка

11

,

949

-

956

.

Mohamed

R

,

Wang

CT

,

Ma

C

и др.

2010

.

Populus CEN / TFL1 регулирует первое начало цветения, идентичность пазушных меристем и высвобождение покоя у Populus

.

Заводской журнал

62

,

674

-

688

.

Noh

B

,

Lee

SH

,

Kim

HJ

,

Yi

G

,

Shin

EA

,

000 Lee

M

ung

Дойл

MR

,

Амасино

RM

,

Но

YS

.

2004

.

Дивергентные роли пары гомологичных белков фактора транскрипции класса jumonji / zinc-finger в регуляции времени цветения Arabidopsis

.

Заводская ячейка

16

,

2601

-

2613

.

Nordström

KJ

,

Albani

MC

,

Джеймс

GV

,

Gutjahr

C

,

Hartwig

B

U4000

U40002

Муфта

G

,

Schneeberger

K

.

2013

.

Идентификация мутации путем прямого сравнения данных полногеномного секвенирования от мутантов и индивидов дикого типа с использованием k-мер

.

Nature Biotechnology

31

,

325

-

330

.

Парк

JY

,

Kim

H

,

Lee

I

.

2017

.

Сравнительный анализ молекулярных и физиологических признаков между многолетником Arabis alpina Pajares и однолетним Arabidopsis thaliana Sy-0

.

Научные отчеты

7

,

13348

.

Schmid

M

,

Uhlenhaut

NH

,

Godard

F

,

Demar

M

,

Bressan

R

,

000

000

000 JGEL

000 9U2000 J

000 Weigel

2003

.

Рассечение путей индукции цветков с использованием анализа глобальной экспрессии

.

Девелопмент

130

,

6001

-

6012

.

Schwab

R

,

Palatnik

JF

,

Riester

M

,

Schommer

C

,

Schmid

M

,

Weigel

.

2005

.

Специфические эффекты микроРНК на транскриптом растений

.

Клетка развития

8

,

517

-

527

.

Searle

I

,

He

Y

,

Turck

F

,

Vincent

C

,

Fornara

F

,

Kröber

RA

Муфта

G

.

2006

.

Фактор транскрипции FLC дает ответ цветения на яровизацию путем репрессии компетентности меристемы и системной передачи сигналов у Arabidopsis

.

Гены и развитие

20

,

898

-

912

.

Sheldon

CC

,

Rouse

DT

,

Finnegan

EJ

,

Peacock

WJ

,

Dennis

ES

.

2000

.

Молекулярная основа яровизации: центральная роль FLOWERING LOCUS C ( FLC )

.

Proceedings of the National Academy of Sciences, USA

97

,

3753

-

3758

.

Shindo

C

,

Lister

C

,

Crevillen

P

,

Nordborg

M

,

Dean

C

.

2006

.

Вариация эпигенетического сайленсинга FLC вносит вклад в естественные вариации в ответе яровизации Arabidopsis

.

Гены и развитие

20

,

3079

-

3083

.

Trapnell

C

,

Pachter

L

,

Salzberg

SL

.

2009

.

TopHat: обнаружение сплайсинговых соединений с помощью RNA-Seq

.

Биоинформатика

25

,

1105

-

1111

.

Trapnell

C

,

Williams

BA

,

Pertea

G

,

Mortazavi

A

,

Kwan

G

000

G

000

Salz M0004

Salon M

000

Salon M

,

Wold

BJ

,

Pachter

L

.

2010

.

Сборка и количественное определение транскриптов с помощью RNA-Seq выявляет неаннотированные транскрипты и переключение изоформ во время дифференцировки клеток

.

Nature Biotechnology

28

,

511

-

515

.

Ван

R

,

Албани

MC

,

Винсент

C

,

Бергонци

S

,

Луан

M

,

Cai

K0002

,

,

,

,

,

Castillo

R

,

Coupland

G

.

2011

.

Aa TFL1 дает возрастную реакцию на яровизацию у многолетнего растения Arabis alpina

.

Заводская ячейка

23

,

1307

-

1321

.

Wang

R

,

Farrona

S

,

Vincent

C

,

Joecker

A

,

Schoof

H

,

Turck

Turck

,

Coupland

G

,

Albani

MC

.

2009

.

PEP1 регулирует многолетнее цветение у Arabis alpina

.

Природа

459

,

423

-

427

.

Willing

EM

,

Rawat

V

,

Maumus

F

и др.

2015

.

Отсутствие симметричного метилирования CG и длительная активность ретротранспозона сформировали геном Arabis alpina

.

Природные растения

1

,

14023 9000 4.

Wu

G

,

Park

MY

,

Conway

SR

,

Wang

JW

,

Weigel

D

,

Poethig

2009

.

Последовательное действие miR156 и miR172 регулирует время развития у Arabidopsis

.

Ячейка

138

,

750

-

759

.

Wu

G

,

Poethig

RS

.

2006

.

Временная регуляция развития побегов Arabidopsis thaliana с помощью miR156 и его мишени SPL3

.

Девелопмент

133

,

3539

-

3547

.

Xu

M

,

Hu

T

,

Zhao

J

,

Park

MY

,

Earley

кВт

,

Wu

G2

Поэтиг

RS

.

2016

.

Функции развития miR156-регулируемых генов SQUAMOSA PROMOTER BINDING PROTEIN-LIKE ( SPL ) в Arabidopsis thaliana

.

PLoS Genetics

12

,

e1006263

.

Янт

L

,

Матье

J

,

Dinh

TT

,

Ott

F

,

Lanz

C

,

000 Wollmann

hen

Шмид

М

.

2010

.

Оркестровка перехода цветков и развития цветков у Arabidopsis с помощью бифункционального транскрипционного фактора APETALA2

.

Заводская ячейка

22

,

2156

-

2170

.

Yun

H

,

Hyun

Y

,

Kang

MJ

,

Noh

YS

,

Noh

B

,

Choi

2011

.

Идентификация регуляторов, необходимых для реактивации FLOWERING LOCUS C во время репродукции Arabidopsis

.

Планта

234

,

1237

-

1250 9000 4.

© Автор (ы) 2018. Опубликовано Oxford University Press от имени Общества экспериментальной биологии.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http: // creativecommons.org / licenses / by / 4.0 /), что разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

Perry's Perennial Pages

Perry's Perennial Pages

    Perry's Многолетник Страницы

Добро пожаловать к веб-страницам доктора Леонарда Перри для онлайновых многолетних и соответствующая информация о садоводстве, служащая Зеленой горе Штат Вермонт и мир.Это ваш исходный источник травянистые многолетники информация и ссылки, празднования закончились 22 года в интернете !

Надеюсь, вам понравится и вы найдете некоторая полезная информация о вашем визите здесь. Не забудьте установить ваша закладка сейчас и проверяйте, как новый контент и ссылки добавляются регулярно

Последние Обновления

садоводство артикулов , садовые туры


Садоводство Статьи
Сотни коротких статей на все аспекты, сгруппированные по теме или дате, с возможностью поиска
Для домашнего садовника
садовые туры, блог , курсы, листовки, общий название списки по языку, радио и видео программ, слайд-шоу
Perennial Arcade
Насколько хорошо вы знаете свой многолетники? Попробуйте эти веселые викторины, игры и кроссворды.
Фотографии и файлы
База данных многолетников и фотографий от А до Я с многолетником Панорамы (фоновые рисунки), Экран Хранитель,
Доктор Кто?
Информация о Dr. Перри.


Вы также можете перемещаться по этим страницы с сайта Карта, на которой вы также можете найти множество старых веб-страниц с этот сайт заархивирован

The Значение растений

«Врачи гораздо чаще назначать садоводство больным раком, деменция и проблемы психического здоровья, Национальная схема здравоохранения (Великобритания) был призван в новом отчете Фонда Королей."(www.kingsfund.org.uk/publications/gardens-and-health)

Цитата месяца:

Общество растет, когда старики сажают деревья, в тени которых, как они знают, они никогда не сядут. - Греческая пословица

60 цветов, начинающихся на букву «G»

Иногда проще всего найти конкретный цветок по первой букве.Если это "G", мы вас прикрываем. Это огромный каталог цветов, в котором перечислено множество цветов, начинающихся с G.

Ниже представлена ​​наша обширная галерея и каталог с цветами, которые начинаются с буквы «G».

Легко понять, почему так любят цветок горечавки. Если для этого есть причина, то его действительно глубокий синий цвет, безусловно, очаровывает смотрящего. Этот эффектный цветок с пятью лепестками в форме трубы также выглядит так, как будто он сидит на своей основной листве.Достигая всего около 4 дюймов в высоту, он распространяется как почвенный покров и образует циновку шириной около 6 дюймов, добавляя красоты и без того живописным ландшафтам европейских альпийских лугов, лугов и лесов, где этот цветок часто встречается.

Связанные: 100 цветов от А до Я

Дудник садовый (Angelica archangelica)

  • Общее название: Дягиль садовый
  • Научное название: Angelica archangelica
  • Тип: Многолетник
  • Вода: Переносит влажную почву
  • PH почвы: 4.От 5 до 7,0
  • Цвет цветка: Зеленовато-белый
  • Особые характеристики: Эффектные цветы, легко выращиваемые
  • Зона устойчивости: от 5 до 7
  • Высота в срок погашения: 36-72 ″
  • Солнце: Полное солнце до частичной тени
  • Подтип: Herb

Садовый бальзам (Impatiens balsamina)

  • Общее название: Садовый бальзам
  • Научное название: Impatiens balsamina
  • Тип: Однолетние
  • Вода: Требует умеренной влажности, переносит засуху
  • PH почвы: 6.1 до 6,5
  • Цвет цветка: белый, красный, оранжевый, желтый, фиолетовый и розовый
  • Особые характеристики: Контейнер, привлекает птиц и бабочек
  • Зона устойчивости: от 2 до 11
  • Высота в зрелом возрасте: 6–30 дюймов
  • Солнце: От полного солнца до частичной тени
  • Подтип: Почвопокровное

Гелиотроп садовый (Valeriana officinalis)

  • Общее название: Гелиотроп садовый
  • Научное название: Valeriana officinalis
  • Тип: Многолетник
  • Вода: От средней до влажной
  • PH почвы : 6–7
  • Цвет цветка: От белого до бледно-розового
  • Особые характеристики: Яркие цветы, ароматные
  • Зона устойчивости: от 4 до 7
  • Высота в зрелом возрасте: 36-60 ′
  • Солнце: Полное солнце
  • Подтип: Herb

Флокс садовый (Phlox Paniculata)

  • Общее название: Садовый флокс
  • Научное название: Phlox Paniculata
  • Тип: Многолетник
  • Вода: Средняя
  • PH почвы: 6.1 до 6,5
  • Цвет цветка: От розово-пурпурного до белого
  • Особые характеристики: Привлекает птиц и бабочек, устойчив к оленям
  • Зона устойчивости: от 4 до 8
  • Высота в зрелом возрасте: 24 ″ -48 ″
  • Солнце: Полное Солнце
  • Подтип: Почвопокровное

Садовые гвоздики (Dianthus «Радужная красота»)

  • Общее название: Садовые гвоздики
  • Научное название: Диантус «Радужная красота»
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6-8
  • Цвет цветка: Пастельная смесь (от белого до розового, от красного до сиреневого)
  • Особые характеристики: Устойчивые к оленям, эффектные цветы, ароматные, легко выращиваемые
  • Зона устойчивости: от 3 до 8
  • Высота в конце срока: 12-18 ”
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Рокресс садовая (Arabis caucasica)

  • Общее название: Садовая рокресс
  • Научное название: Arabis caucasica
  • Тип: Многолетник
  • Вода: От сухого до среднего
  • PH почвы: 5.5-5,8
  • Цвет цветка: Белый
  • Особые характеристики: Устойчивые к оленям, эффектные цветы, срезанные цветы
  • Зона устойчивости: от 4 до 7
  • Высота в срок погашения: 6-12 ′
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Садовый инвентарь (Matthiola incana)

  • Общее название: Садовый инвентарь
  • Научное название: Matthiola incana
  • Тип: Годовой
  • Вода: Умеренная влажность
  • PH почвы: 6.От 8 до 7,5
  • Цвет цветка: Розовый, посадочный модуль, фиолетовый. белый, желтый, красный
  • Особые характеристики: Устойчив к оленям, ароматный
  • Зона устойчивости: от 7 до 10
  • Рост в зрелом возрасте: от 24 дюймов до 48 дюймов
  • Солнце: Полное Солнце
  • Подтип: Почвопокровное

Вербена садовая (Verbena × hybrida)

  • Общее название: Вербена садовая
  • Научное название: Verbena × hybrida
  • Тип: Многолетник
  • Вода: Средняя
  • PH почвы: 5.5-7,0
  • Цвет цветка: Синий, фиолетовый, пурпурный, розовый, красный, желтый, белый и двухцветный
  • Особые характеристики: Привлекает бабочек, эффектные цветы, легко выращивать, контейнер
  • Зона устойчивости: 9-10
  • Высота в срок погашения: 9-18 ′
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Гардения (Gardenia jasminoides)

  • Общее название: Gardenia
  • Научное название: Gardenia jasminoides
  • Тип: Кустарник
  • Вода: Требуется умеренная влажность
  • PH почвы: 5.6-6
  • Цвет цветка: Белый
  • Особые характеристики: Срезанные цветы, ароматные, эффектные цветы
  • Зона устойчивости: 6-10
  • Высота в срок погашения: 36-48 ″
  • Солнце: Полное солнце, частичная тень
  • Подтип: Evergreen

Гаура (Gaura lindheimeri «Багровые бабочки»)

  • Общее название: Гаура
  • Научное название: Gaura lindheimeri «Багровые бабочки»
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6-8
  • Цвет цветка: Ярко-розовый
  • Особые характеристики: Яркие цветы, контейнер
  • Зона устойчивости: от 5 до 8
  • Высота в конце срока: 12-18 ”
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Гаура (Gaura lindheimeri «Nugaupapil» PAPILLON)

  • Общее название: Gaura
  • Научное название: Gaura lindheimeri «Nugaupapil» ПАПИЛОН
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6-8
  • Цвет цветка: Белый
  • Особые характеристики: Яркие цветы, контейнер
  • Зона устойчивости: от 5 до 9
  • Высота в конце срока: 12-18 ”
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Гаура (Gaura lindheimeri «Кружащиеся бабочки»)

  • Общее название: Gaura
  • Научное название: Gaura lindheimeri «Вихревые бабочки»
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6-8
  • Цвет цветка: Белый
  • Особые характеристики: Яркие цветы
  • Зона устойчивости: от 5 до 9
  • Высота в период погашения: 24-36 ″
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Горечавка (Gentiana acaulis)

  • Общее название: Gentian
  • Научное название: Gentiana acaulis
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 5.5-7
  • Цвет цветка: Deep blue
  • Зона устойчивости: от 3 до 7
  • Высота в конце срока: 3-9 ″
  • Солнце: Полное солнце до частичной тени
  • Подтип: Почвопокровное

Горечавка (Gentiana alba)

  • Общее название: Gentian
  • Научное название: Gentiana alba
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6-8
  • Цвет цветка: От белого до желтовато-белого до зеленовато-белого
  • Особые характеристики: Яркие цветы
  • Зона устойчивости: от 3 до 7
  • Высота в период погашения: 24-36 ″
  • Солнце: Полное солнце до частичной тени

Горечавка вероника вероника (Veronica gentianoides)

  • Общее название: Горечавка вероника
  • Научное название: Veronica gentianoides
  • Тип: Многолетник
  • Вода: Средняя
  • PH почвы: 6-8
  • Цвет цветка: Синий
  • Особые характеристики: Легко выращивать
  • Зона устойчивости: от 4 до 7
  • Высота в период погашения: 12-18 ′
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Герань (Geranium Albanum)

  • Общее название: Герань
  • Научное название: Geranium Albanum
  • Тип: Многолетник
  • Вода: Требует умеренной влажности, переносит засуху
  • PH почвы: 5.От 5 до 6,0
  • Цвет цветка: Розовый с темно-розовыми прожилками
  • Особые характеристики: Привлекает птиц и бабочек, легко выращивать
  • Зона устойчивости: от 5 до 8
  • Рост в зрелом возрасте: 12–18 дюймов
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Герань (Пеларгония)

  • Общее название: Герань
  • Научное название: Pelargonium
  • Тип: Годовой
  • Вода: Требуется умеренная влажность
  • PH почвы: 5.От 5 до 6,8
  • Цвет цветка: белый, красный, розовый, фиолетовый или синий
  • Особые характеристики: Устойчивый к оленям, быстрорастущий
  • Зона устойчивости: от 8 до 10
  • Рост в зрелом возрасте: от 24 дюймов до 48 дюймов
  • Солнце: Полное Солнце
  • Подтип: Почвопокровное

Гербера ромашка (Gerbera jamesonii)

  • Общее название: Гербера ромашка
  • Научное название: Gerbera jamesonii
  • Тип: Годовой
  • Вода: Требуется умеренная влажность
  • PH почвы: 6.От 1 до 7,5
  • Цвет цветка: Оранжевый Красный Желтый
  • Особые характеристики: Контейнер для срезанных цветов
  • Зона устойчивости: от 8 до 9
  • Высота в зрелом возрасте: от 12 дюймов до 24 дюймов
  • Солнце: Полное Солнце
  • Подтип: Почвопокровное, комнатное растение

Немецкий кустарник (Teucrium Fruticans)

  • Общее название: Germander Shrub
  • Научное название: Teucrium Fruticans
  • Тип: Кустарник, Многолетник
  • Вода: от сухого до среднего
  • PH почвы: 6.1 к 7,8
  • Цвет цветка: Синий, Фиолетовый
  • Особые характеристики: Переносит засуху, яркие цветы
  • Зона устойчивости: от 8 до 10
  • Высота в зрелом возрасте: 48–72 дюйма
  • Солнце: Полное Солнце
  • Подтип: Evergreen

Гигантский бочонок кактус (Echinocactus Platyacanthus)

  • Общее название: Гигантский бочонок кактус
  • Научное название: Echinocactus Platyacanthus
  • Тип: Кактус / Сочный
  • Вода: Сухая
  • PH почвы: 6.1 к 7,8
  • Цвет цветка: Желтый
  • Особые характеристики: Переносит засуху
  • Зона устойчивости: от 9 до 11
  • Высота в зрелом возрасте: от 36 дюймов до 72 дюймов
  • Солнце: Полное Солнце

Кактус с гигантским подбородком (Gymnocalycium Saglionis)

  • Общее название: Кактус с гигантским подбородком
  • Научное название: Gymnocalycium Saglionis
  • Тип: Кактус / Сочный
  • Вода: Сухая
  • Почва PH : 6.1 к 7,8
  • Цвет цветка: белый, розовый
  • Особые характеристики: Контейнер, переносит засуху
  • Зона устойчивости: от 9 до 11
  • Высота в зрелом возрасте: от 12 дюймов до 36 дюймов
  • Солнце: От полного солнца до частичного оттенка

Иссоп гигантский (Агасташ «Голубая фортуна»)

  • Общее название: Гигантский иссоп
  • Научное название: Agastache «Blue Fortune»
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6-8
  • Цвет цветка: Лавандово-синий
  • Особые характеристики: Привлекает бабочек, устойчивые к оленям, ароматные, эффектные цветы
  • Зона устойчивости: от 5 до 9
  • Высота в период погашения: 24-36 ″
  • Солнце: Полное солнце до частичной тени
  • Подтип: Herb

Ревень гигантский (Gunnera manicata)

  • Общее название: Гигантский ревень
  • Научное название: Gunnera manicata
  • Тип: Многолетник
  • Вода: От средней до влажной
  • PH почвы: 6.1-6,5
  • Цвет цветка: Красновато-зеленый
  • Особые характеристики: Яркие цветы
  • Зона устойчивости: от 7 до 10
  • Высота в срок погашения: 72-120 ′
  • Солнце: Оттенок детали
  • Подтип: Aquatic

Эхинацея обыкновенная (Echinacea simulata) эхинацея пурпурная (Echinacea simulata)

  • Общее название: Пурпурная эхолотка
  • Научное название: Echinacea simulata
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6.5-7,0
  • Цвет цветка: Бледно-розово-фиолетовый
  • Особые характеристики: Привлекает птиц и бабочек, устойчивы к оленям, эффектные цветы, легко выращивать
  • Зона устойчивости: от 5 до 8
  • Высота в период погашения: 24-36 ″
  • Солнце: Полное солнце до частичной тени
  • Подтип: Почвопокровное

Глобус Амарант (Gomphrena Globosa)

  • Общее название: Globe Amaranth
  • Научное название: Gomphrena Globosa
  • Тип: Годовой
  • Вода: Умеренная влажность, устойчивость к засухе
  • PH почвы: 5.8 к 6,2
  • Цвет цветка: От белого до желтого с ярко-пурпурными прицветниками
  • Особые характеристики: Привлекает бабочек, контейнер
  • Зона устойчивости: от 2 до 11
  • Рост в период погашения: от 1 до 2 футов
  • Солнце: Полное Солнце
  • Подтип: Почвопокровное

Глобус цветок (Trollius × cultorum)

  • Общее название: Цветок земного шара
  • Научное название: Trollius × cultorum
  • Тип: Многолетник
  • Вода: Переносит влажную почву
  • PH почвы: 6-8
  • Цвет цветка: Желтый, оранжевый и кремовый
  • Особые характеристики: Эффектные цветы, легко выращиваемые
  • Зона устойчивости: от 3 до 7
  • Высота в период погашения: 24-36 ″
  • Солнце: Полное солнце до частичной тени
  • Подтип: Почвопокровное

Глобус цветок (Trollius europaeus)

  • Общее название: Цветок земного шара
  • Научное название: Trollius europaeus
  • Тип: Многолетник
  • Вода: От средней до влажной
  • PH почвы: 5-7
  • Цвет цветка: Желтый
  • Особые характеристики: Переносит кролика, эффектные цветы
  • Зона устойчивости: от 3 до 6
  • Высота в конце срока: 18-24 ”
  • Солнце: От частичного до полного оттенка
  • Подтип: Почвопокровное

Глобус цветок (Trollius ledebourii)

  • Общее название: Цветок земного шара
  • Научное название: Trollius ledebourii
  • Тип: Многолетник
  • Вода: От средней до влажной
  • PH почвы: 5.8 - 6,8
  • Цвет цветка: Оранжевый
  • Особые характеристики: Переносит кролика, эффектный цветок
  • Зона устойчивости: от 3 до 7
  • Высота в срок погашения: 24-36 ′
  • Солнце: От частичного до полного оттенка
  • Подтип: Почвопокровное

Чертополох земной (Echinops bannaticus «Blue Globe»)

  • Общее название: Чертополох
  • Научное название: Echinops bannaticus «Blue Globe»
  • Тип: Многолетник
  • Вода: Средняя
  • PH почвы: 5.8 к 6,8
  • Цвет цветка: Темно-синий
  • Особые характеристики: Эффектные цветы, легко выращиваемые
  • Зона устойчивости: от 3 до 8
  • Высота в срок погашения: 24-36 ′
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Кактус из козьего рога (Astrophytum senile)

  • Общее название: Кактус из козьего рога
  • Научное название: Astrophytum senile
  • Тип: Кактус / Сочный
  • Вода: Сухая
  • PH почвы: 8-9
  • Цвет цветка: Желтый
  • Особые характеристики: Яркие цветы
  • Зона устойчивости: 9-11
  • Высота в период погашения: 12-48 ″
  • Солнце: Полное солнце, частичная тень
  • Подтип: Комнатное растение

Козья борода (Aruncus Aethusifolius)

  • Общее название: Козья борода
  • Научное название: Aruncus Aethusifolius
  • Тип: Многолетник
  • Вода: Переносит влажную почву
  • PH почвы: 6.1 к 7,8
  • Цвет цветка: Кремовый
  • Особые характеристики: Эффектные цветы, легко выращиваемые
  • Зона устойчивости: от 3 до 9
  • Высота в зрелом возрасте: от 9 до 12 дюймов
  • Солнце: Полное солнце до частичной тени
  • Подтип: Почвопокровное

Козья борода (Aruncus Dioicus)

  • Общее название: Козья борода
  • Научное название: Aruncus Dioicus
  • Тип: Многолетник
  • Вода: Умеренная влажность
  • PH почвы: 6.1 к 7,8
  • Цвет цветка: Кремовый
  • Особые характеристики: Яркие цветы, переносит кролика
  • Зона устойчивости: от 4 до 8
  • Высота в зрелом возрасте: 48–72 дюйма
  • Солнце: Полное солнце до частичной тени

Годеция (Clarkia amoena)

  • Общее название: Godetia
  • Научное название: Clarkia amoena
  • Тип: Годовой
  • Цвет цветка: Розовый и белый
  • Особые характеристики: Легко выращивать / Подходит для срезанных цветов / Привлекает бабочек и птиц / Быстрорастущий
  • Зона устойчивости: от 2 до 11
  • Рост в зрелом возрасте: от 24 дюймов до 48 дюймов
  • Солнце: Много солнца и полутень

Кактус с рогом богов (Astrophytum Capricorne)

  • Общее название: Gods Horn Cactus
  • Научное название: Astrophytum Capricorne
  • Тип: Кактус / Сочный
  • Вода: Сухая
  • PH почвы: 6.1 к 7,8
  • Цвет цветка: Желтый
  • Особые характеристики: Контейнер, переносит засуху
  • Зона устойчивости: от 9 до 11
  • Высота в зрелом возрасте: от 12 дюймов до 48 дюймов
  • Солнце: Полное Солнце
  • Подтип: Evergreen

Завод по производству золотой пыли (Аукуба)

  • Общее название: Завод по производству золотой пыли
  • Научное название: Aucuba
  • Тип: Кустарник
  • Вода: Требуется умеренная влажность
  • PH почвы: 5.1-6,5
  • Цвет цветка: Белый
  • Особые характеристики: Ядовитый, контейнер, легко выращивать
  • Зона устойчивости: 6-10
  • Высота в срок погашения: 96-120 ″
  • Солнце: От частичного до полного затенения
  • Подтип: Evergreen

Золотой бамбук (Phyllostachys Aurea)

  • Общее название: Golden Bamboo
  • Научное название: Phyllostachys Aurea
  • Тип: Кустарник
  • Вода: Умеренная
  • PH почвы: 6.1 к 7,8
  • Особые характеристики: Легко выращивать,
  • Зона устойчивости: от 6 до 11
  • Высота в период погашения: от 240 ″ до 360 ″
  • Солнце: От полного солнца до частичного оттенка
  • Подтип: Evergreen

Кактус Золотая бочка (Echinocactus Grusonii)

  • Общее название: Golden Barrel Cactus
  • Научное название: Echinocactus Grusonii
  • Тип: Кактус / Сочный
  • Вода: Сухая
  • PH почвы: 6.1 к 7,8
  • Цвет цветка: Желтый
  • Особые характеристики: Контейнер, переносит засуху
  • Зона устойчивости: от 9 до 11
  • Высота в зрелом возрасте: от 24 дюймов до 36 дюймов
  • Солнце: Полное Солнце

Золотая ромашка (Anthemis Tinctoria)

  • Общее название: Золотая ромашка
  • Научное название: Anthemis Tinctoria
  • Тип: Многолетник
  • Вода: Переносит засуху
  • PH почвы: 6.От 1 до 7,5
  • Цвет цветка: Желтый
  • Особые характеристики: Ароматные, эффектные цветы, срезанные цветы
  • Зона устойчивости: от 3 до 7
  • Высота в зрелом возрасте: 24 ″ -36 ″
  • Солнце: Полное солнце
  • Подтип: вечнозеленый

Чолла золотая (Cylindropuntia Echinocarpa)

  • Общее название: Golden Cholla
  • Научное название: Cylindropuntia Echinocarpa
  • Тип: Кактус / Сочный
  • Вода: Сухая
  • PH почвы: 6.1 к 7,8
  • Цвет цветка: Желтый
  • Особые характеристики: Переносит засуху
  • Зона устойчивости: от 9 до 11
  • Высота в зрелом возрасте: от 36 дюймов до 48 дюймов
  • Солнце: Полное Солнце

Коридал золотой (Corydalis aurea)

  • Общее название: Golden corydalis
  • Научное название: Corydalis aure
  • Тип: Многолетник
  • Вода: Средняя
  • PH почвы: 6.1-7,8
  • Цвет цветка: Желтый
  • Особые характеристики: Ядовитый
  • Зона устойчивости: 5-9
  • Высота в срок погашения: 6-12 ″
  • Солнце: Полная тень
  • Подтип: Почвопокровное

Золотая капля росы (Duranta Erecta)

  • Общее название: Golden Dew Drop
  • Научное название: Duranta Erecta
  • Тип: Кустарник
  • Вода: Умеренная
  • PH почвы: 5.С 6 по 6
  • Цвет цветка: Фиолетовый
  • Особые характеристики: Контейнер, привлекающий птиц и бабочек
  • Зона устойчивости: от 9 до 11
  • Рост в зрелом возрасте: 120–180 дюймов
  • Солнце: От полного солнца до частичного оттенка
  • Подтип: Evergreen

Золотое колено (Chrysogonum virginianum)

  • Общее название: Золотое колено
  • Научное название: Chrysogonum virginianum
  • Тип: Многолетник
  • Вода: От средней до влажной
  • Почва PH: 6-7.5
  • Цвет цветка: Желтый
  • Особые характеристики: Яркие цветы
  • Зона устойчивости: от 5 до 9
  • Высота в конце срока погашения: 3-4 дюйма
  • Солнце: От частичного до полного оттенка
  • Подтип: Почвопокровное

Хвост золотой крысы (Cleistocactus winteri)

  • Общее название: Хвост золотой крысы
  • Научное название: Cleistocactus winteri
  • Тип: Кактус / Сочный
  • Вода: Сухая
  • PH почвы: 6.1-7,8
  • Цвет цветка: Апельсин, Лосось, Коралл
  • Особые характеристики: Яркие цветы в контейнере, привлекают колибри
  • Зона устойчивости: 9-12
  • Высота в срок погашения: 6-12 ″
  • Солнце: Полное Солнце, Частичное Солнце
  • Подтип: Комнатное растение

Золотарник (Solidago Hispida)

  • Общее название: Goldenrod
  • Научное название: Solidago hispida
  • Тип: Многолетник
  • Вода: Переносит засуху
  • Почва PH : 5.От 1 до 7,5
  • Цвет цветка: Желтый
  • Особые характеристики: Привлекает птиц и бабочек, эффектные цветы, хорошо переносит оленей
  • Зона устойчивости: от 3 до 8
  • Высота в период погашения: 12–36 дюймов
  • Солнце: Полное солнце

Золотарник (Solidago rigida)

  • Общее название: Goldenrod
  • Научное название: Solidago rigida
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6-8
  • Цвет цветка: Желтый
  • Особые характеристики: Привлекает бабочек, устойчивые к оленям, эффектные цветы
  • Зона устойчивости: 3-9
  • Высота в зрелости: 36-60 ″
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Золотарник (Solidago virgaurea subsp.минут)

  • Общее название: Goldenrod
  • Научное название: Solidago virgaurea subsp. minuta
  • Тип: Многолетник
  • Вода: Переносит засуху
  • PH почвы: 4,7-5,4
  • Цвет цветка: Желтый
  • Особые характеристики: Привлекает бабочек, устойчивы к оленям, эффектные цветы, легко выращивать
  • Зона устойчивости: 5-8
  • Высота в конце срока: 3-9 ″
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Гусиная шея (Lysimachia clethroides)

  • Общее название: Гусиная шея
  • Научное название: Lysimachia clethroides
  • Тип: Многолетник
  • Вода: Требуется умеренная влажность
  • PH почвы: 6-8
  • Цвет цветка: Белый
  • Особые характеристики: Переносит кролика, эффектные цветы
  • Зона устойчивости: 3-8
  • Высота в период погашения: 24-36 ″
  • Солнце: Полное солнце до частичной тени
  • Подтип: Почвопокровное

Расторопша пятнистая (Echinops sphaerocephalus)

  • Общее название: Чертополох
  • Научное название: Echinops sphaerocephalus
  • Тип: Многолетник
  • Вода: Переносит засуху
  • PH почвы: 8-10
  • Цвет цветка: Белый
  • Особые характеристики: Привлекает птиц, эффектные цветы, срезанные цветы, легко выращивать
  • Зона устойчивости: от 3 до 9
  • Высота в период погашения: 24-36 ″
  • Солнце: Полное солнце
  • Подтип: Почвопокровное

Барвинок большой (Vinca major)

  • Общее название: Барвинок большой
  • Научное название: Vinca major
  • Тип: Многолетник
  • Вода: От сухого до среднего
  • PH почвы: 5.5-5,8
  • Цвет цветка: Фиолетово-синий
  • Особые характеристики: Яркие цветы, устойчивые к оленям
  • Зона устойчивости: от 7 до 9
  • Высота в период погашения: 6-18 ′
  • Солнце: Полное солнце до частичной тени
  • Подтип: Почвопокровное

Большой белый триллиум (Trillium grandiflorum)

  • Общее название: Большой белый триллиум
  • Научное название: Trillium grandiflorum
  • Тип: Многолетник
  • Вода: Средняя
  • PH почвы: 5.От 6 до 6,0
  • Цвет цветка: Белый
  • Особые характеристики: Яркие цветы
  • Зона устойчивости: от 4 до 8
  • Высота в срок погашения: 8-18 ″
  • Солнце: От частичного до полного оттенка
  • Подтип : Почвопокровное
.